ID: 1096717771

View in Genome Browser
Species Human (GRCh38)
Location 12:53501374-53501396
Sequence CAGTCACGGTGGCGCCCGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096717760_1096717771 17 Left 1096717760 12:53501334-53501356 CCCTAGCTCGTCGGCTGTGTATT 0: 1
1: 0
2: 0
3: 3
4: 16
Right 1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1096717759_1096717771 21 Left 1096717759 12:53501330-53501352 CCGGCCCTAGCTCGTCGGCTGTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1096717757_1096717771 23 Left 1096717757 12:53501328-53501350 CCCCGGCCCTAGCTCGTCGGCTG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1096717761_1096717771 16 Left 1096717761 12:53501335-53501357 CCTAGCTCGTCGGCTGTGTATTG 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1096717758_1096717771 22 Left 1096717758 12:53501329-53501351 CCCGGCCCTAGCTCGTCGGCTGT 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096717771 Original CRISPR CAGTCACGGTGGCGCCCGCG GGG Exonic
900991894 1:6101955-6101977 CAGCCAGGGTGGCCCCGGCGGGG - Exonic
903883855 1:26530067-26530089 CAGTCCGGCGGGCGCCCGCGAGG + Intronic
907209550 1:52808084-52808106 CGGACACGGTGGCTCACGCGTGG + Intronic
1067496008 10:46760860-46760882 CGGGCACGGTGGCTCCCGCCTGG + Intergenic
1067598648 10:47579530-47579552 CGGGCACGGTGGCTCCCGCCTGG - Intergenic
1073095793 10:100978982-100979004 CAGTCACCGTGTGGCCCGTGTGG + Exonic
1073117978 10:101103028-101103050 CAGTCACAGTGGCTCACGCCTGG - Intronic
1076908286 10:133373803-133373825 CAGGCACGGTGGCAGCGGCGTGG + Intergenic
1087318554 11:96633340-96633362 CAGGCACGGTGGCTCACGCATGG + Intergenic
1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG + Exonic
1096774003 12:53953201-53953223 CGGGCAGGGCGGCGCCCGCGGGG + Intergenic
1098281222 12:68864733-68864755 CAGTCACGGTGGCTCACACCTGG + Intronic
1100985624 12:100199718-100199740 CAGTCGCGCTGGTTCCCGCGCGG + Intronic
1112592333 13:100775298-100775320 CAGGCACGGTGGCTCACGCCTGG - Intergenic
1113648412 13:112015226-112015248 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113648420 13:112015262-112015284 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113648428 13:112015298-112015320 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113648436 13:112015334-112015356 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113648444 13:112015370-112015392 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113648501 13:112015658-112015680 CGGTCACGGAAGCGCCCACGGGG + Intergenic
1113884418 13:113651042-113651064 CACTCTCGGTGGGGGCCGCGGGG - Intronic
1115564656 14:34614639-34614661 CAGCCAAGGTGGCTCACGCGTGG + Intronic
1115851759 14:37595067-37595089 CAGTCACCCGAGCGCCCGCGCGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1123664786 15:22599613-22599635 CGGTCACGGTGGCTCACGCCTGG - Intergenic
1123676512 15:22714870-22714892 CAGCCGCTGTGGCGCCCGGGCGG - Intergenic
1124251073 15:28106857-28106879 CAGGCCCGGAGGCGGCCGCGGGG - Intergenic
1124257087 15:28153075-28153097 CAGGCACGGTGGCTCACGCCTGG + Intronic
1131160613 15:90102493-90102515 CCGCCCCGGTGGTGCCCGCGCGG - Exonic
1132105626 15:99060423-99060445 CAGGCACGGTGGCTCACGCCTGG - Intergenic
1133464876 16:6019570-6019592 CAGCCCCGGAGGCGCGCGCGTGG - Intronic
1135535987 16:23294849-23294871 CAGGCATGGTGGCGCGCGCCTGG + Intronic
1136270446 16:29145283-29145305 CAGTCACGGCACCTCCCGCGTGG - Intergenic
1136676244 16:31909271-31909293 CAGGCACGGTGGCGCATGCCTGG - Intronic
1142174402 16:88638626-88638648 CCGTCATGGTGGCGGCAGCGGGG - Exonic
1142680427 17:1544659-1544681 CGGGCACGGTGGCTCCCGCCTGG + Intronic
1142880742 17:2880848-2880870 CAGGCACGGTGGCTCACGCCTGG + Intronic
1157063109 18:44316283-44316305 CAGGCATGGTGGTGCGCGCGAGG - Intergenic
1157842037 18:50967949-50967971 CGCGCTCGGTGGCGCCCGCGCGG - Intergenic
1160954882 19:1686561-1686583 CAGGCGCGGTGGCTCCCGCCTGG - Intergenic
1161639530 19:5412515-5412537 CAGGCACGGTGGCTCACGCCTGG + Intergenic
1163954241 19:20620676-20620698 CAGTCATGGTGGCGCACACCTGG - Exonic
1167493599 19:49805658-49805680 CAGGTACGGTGGCGCCCCCCAGG + Exonic
925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG + Exonic
927753086 2:25687183-25687205 CAGGCACGGTGGCTCACGCTTGG + Intergenic
930061617 2:47294348-47294370 CAGGCACGGTGGCTCACGCCTGG + Intergenic
930088429 2:47514750-47514772 CAGTCATGGTGGTGCACGCCTGG - Intronic
944809844 2:203317298-203317320 CAGGCACGGTGGCTCACGAGGGG - Intergenic
1169100956 20:2948673-2948695 CAGGCACGGTGGCTCACGCCTGG + Intronic
1172611598 20:36256495-36256517 CAGTCACGGTGGCTCTGGTGAGG - Exonic
1172853148 20:37981165-37981187 CAGTCTCGGTGGCGGCAGCCTGG - Intergenic
1175893971 20:62327927-62327949 CAGTCACAGGGGCGGCAGCGGGG + Exonic
1178568601 21:33713152-33713174 CAGGCACGGTGGCTCCCACCTGG - Intronic
1178910232 21:36668088-36668110 CAGGCACGGTGGCTCACGCCTGG + Intergenic
1179898050 21:44374285-44374307 CAGGCACGGTGGCTCACGCCTGG - Intronic
1181943627 22:26498264-26498286 CAGGCACGGTGGCTCACGCCTGG + Intronic
1185260397 22:49858553-49858575 CAGTCACGGTAGCTCCAGCTGGG - Intronic
950032527 3:9862258-9862280 CAGACACGCTGGCCCCCGGGTGG - Intergenic
950415633 3:12867578-12867600 CAGACACGCTGGCCCCCGGGTGG - Intronic
963145334 3:141988220-141988242 CAGGCACGGTGGCTCACGCCTGG - Intronic
966762140 3:183428153-183428175 CTGTCACGGGAGCCCCCGCGGGG - Exonic
966999838 3:185323607-185323629 CAGGCACGGTGGCTCACGCCTGG - Intronic
967547195 3:190745256-190745278 CAGGCACGGTGGCTCACGCGTGG - Intergenic
968164362 3:196452606-196452628 CAGGCACGGTGGCTCACGCCTGG + Intergenic
968451247 4:677027-677049 CAGACACGGTGGCGCCCCCAGGG + Intronic
981427686 4:144622412-144622434 CAGGCAGGGTGGCGCCAGCCAGG + Intergenic
993934751 5:93986335-93986357 CAGACACGGTGGCTGCCGGGCGG - Intronic
995106560 5:108382146-108382168 CAGTTGCGGTGGCGCGCTCGTGG + Intergenic
1006717699 6:36130781-36130803 CGGTCAAGGTGGCGCTGGCGAGG - Intronic
1007137807 6:39539617-39539639 CAGGCACGGTGGCTCACGCCTGG - Intronic
1010200092 6:73274854-73274876 CAGTCCAGGTGGCGCTCGCATGG - Intronic
1010794878 6:80106936-80106958 CAGGCTCGCAGGCGCCCGCGAGG + Intronic
1015523917 6:134158140-134158162 TGGTCACGGTGGCTCCCGCCTGG - Intergenic
1018319649 6:162593874-162593896 CAGGCACGGTGGCTCACGCCTGG + Intronic
1018816660 6:167337428-167337450 CAGGCACGGTGGAGCCTGGGGGG + Intronic
1021798780 7:24284260-24284282 CACTCACGGTGGCTGGCGCGCGG - Exonic
1025707997 7:63884786-63884808 CAGGCACGGTGGCTCCCGCCTGG - Intergenic
1027390299 7:77696982-77697004 CGGTCTCGGTGGGGCCCGAGAGG + Exonic
1036200851 8:6770748-6770770 CAGGCACGGTGGCTCACGCCTGG + Intergenic
1044675074 8:94720112-94720134 CGGTCGCGGTGGCGGCCGCGCGG + Intronic
1045596150 8:103659188-103659210 CAGTCACAGTGGTGCCTGTGGGG + Intronic
1047285548 8:123484570-123484592 CAGACATGGTGGCGCCCACCAGG - Intergenic
1049435719 8:142585382-142585404 CAGTCACGGTGGCCTCTGCGTGG + Intergenic
1049628255 8:143636326-143636348 CAGCCACGGCCGCCCCCGCGAGG + Intronic
1049761439 8:144333689-144333711 CAGGCACCGAGGCGCGCGCGGGG - Exonic
1049809224 8:144556007-144556029 CAGGCACGGTGGCTCACGCCTGG + Intronic
1051652995 9:19348947-19348969 CAGTCATGGTGGGGCACGCCTGG - Intronic
1057600719 9:96454824-96454846 CAGTCACAGTGGGGGCTGCGTGG + Intronic
1062108416 9:134768234-134768256 CAGCCACGGTAGCGCCCAGGAGG - Intronic
1185496827 X:560837-560859 CAGGCACGGTGGCTCACGCCTGG - Intergenic
1185680301 X:1883471-1883493 CAGGCACGGTGGCTCACGCCTGG - Intergenic
1190884538 X:54519812-54519834 CAGGCACGGTGGCTCACGCCTGG - Intergenic
1194025376 X:88745194-88745216 CAGGCACGGTGGCTCACGCCTGG + Intergenic
1194300823 X:92183515-92183537 CAGGCACGGTGGCTCACGCCTGG - Intronic