ID: 1096719661

View in Genome Browser
Species Human (GRCh38)
Location 12:53511747-53511769
Sequence TAGTATGTGCTTTATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096719661_1096719663 4 Left 1096719661 12:53511747-53511769 CCATCCACATAAAGCACATACTA 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1096719663 12:53511774-53511796 TCCTGTGAGTACTTGCTGCCAGG 0: 1
1: 0
2: 3
3: 11
4: 135
1096719661_1096719668 29 Left 1096719661 12:53511747-53511769 CCATCCACATAAAGCACATACTA 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1096719668 12:53511799-53511821 GCCAAGGGCCCTTGTCTCCAAGG 0: 1
1: 0
2: 2
3: 9
4: 175
1096719661_1096719666 14 Left 1096719661 12:53511747-53511769 CCATCCACATAAAGCACATACTA 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1096719666 12:53511784-53511806 ACTTGCTGCCAGGATGCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 174
1096719661_1096719665 13 Left 1096719661 12:53511747-53511769 CCATCCACATAAAGCACATACTA 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1096719665 12:53511783-53511805 TACTTGCTGCCAGGATGCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096719661 Original CRISPR TAGTATGTGCTTTATGTGGA TGG (reversed) Intronic
900465713 1:2824551-2824573 AAGTAGGTGCCTTATGTGGTGGG + Intergenic
904519624 1:31084762-31084784 TAGTTTGTTCTTTAAGTGTAGGG - Intergenic
904818812 1:33226917-33226939 TAGTATGTGGTTTTTGTGATTGG - Intergenic
905150770 1:35925599-35925621 TAGTCTGTGGTTTATGAGTATGG + Exonic
908515851 1:64892269-64892291 TAGTATGTGCTTTTTTGGGGGGG + Intronic
911096892 1:94062251-94062273 TAGTATGTTTGGTATGTGGAAGG - Intronic
914775597 1:150731515-150731537 TAAAATGTGCTTTATGGAGAAGG + Exonic
915230479 1:154442157-154442179 TAGTATGTGCTTGAGGGGGCTGG + Intronic
915421787 1:155788724-155788746 TAGGATGTGCTTTGTGTGTAAGG - Intronic
916259287 1:162824759-162824781 CAGAATGTGCATTATCTGGATGG - Intronic
916441245 1:164827178-164827200 TAATATATACTTTAAGTGGAAGG - Intronic
917070093 1:171141076-171141098 TACTGTGTACTTTATGTGTAGGG + Intronic
1063328989 10:5136948-5136970 TGGTATTTGCTTTATGTTGGTGG - Intergenic
1065900456 10:30202527-30202549 TAGTATTTGCATTATTTGGAGGG - Intergenic
1066322059 10:34313079-34313101 GAGTATGTACTTTAGGAGGAGGG - Intronic
1070206175 10:74264755-74264777 TAGTATGTAATTTTTGTGTATGG + Intronic
1074608358 10:114996886-114996908 TAGTACCTGCCTTCTGTGGATGG - Intergenic
1074710077 10:116169859-116169881 TAGTATGTGCTGTCTGTGGATGG - Intronic
1075483821 10:122804155-122804177 TATTATGTGCTATGTATGGAAGG - Intergenic
1077475424 11:2788069-2788091 TAGAATGTGGTGAATGTGGATGG + Intronic
1079006856 11:16797596-16797618 GAGGATGTGCTTTATGTTGGAGG - Intronic
1080297034 11:30742043-30742065 TAGAATGTGGCTTAAGTGGAAGG + Intergenic
1080798675 11:35589368-35589390 TAGAAGGTGCTTTCCGTGGAGGG + Intergenic
1081780567 11:45708415-45708437 TTGTATGTTCTGTATGAGGAAGG - Intergenic
1085571846 11:77566190-77566212 TAATATGTGCTTTATATGTCTGG + Intronic
1086254566 11:84860439-84860461 TAGAATGTATTTTATGTGTATGG + Intronic
1087395835 11:97596755-97596777 TAGTATTTGCTTTTTGTGGCAGG - Intergenic
1087630614 11:100646677-100646699 TAGTAGGTACTTTATATGCATGG - Intergenic
1087912312 11:103768167-103768189 AACTATGTGCTTAATGAGGAAGG - Intergenic
1088011424 11:105005934-105005956 TAGCATGTGGTTTCTGTTGAGGG + Intronic
1088616519 11:111635317-111635339 TAGTAAGTGATTTATGTGCTGGG + Intronic
1089940001 11:122406378-122406400 AAGTATTTGCCGTATGTGGAGGG - Intergenic
1091565128 12:1642513-1642535 CTGTATGTGCTGTATGTGGGTGG + Intronic
1092953746 12:13530941-13530963 TAATAAGTACTTTATGTGGATGG - Intergenic
1092977635 12:13760748-13760770 TACTCTGTGCTAAATGTGGAAGG - Intronic
1094285177 12:28784415-28784437 TAGTTTATTCTTTACGTGGAGGG - Intergenic
1094440663 12:30472335-30472357 TAGTTTATTCTTTATGTGTAGGG - Intergenic
1096719661 12:53511747-53511769 TAGTATGTGCTTTATGTGGATGG - Intronic
1100864941 12:98847357-98847379 TAGTATTTGCTTTCTGTGCCTGG + Intronic
1103156478 12:118689433-118689455 TAGTAGGTGCTTGCTGTAGAAGG - Intergenic
1104332479 12:127860146-127860168 TTGTTTGTGCTTTATGTAAATGG - Intergenic
1106763073 13:32886788-32886810 TAGCATGTGGTTAATGTGAAAGG + Intergenic
1107043162 13:35969915-35969937 TAGTATCTTCTTGCTGTGGAAGG - Intronic
1107214920 13:37905194-37905216 AAGTATGAGATTTATGTGGTGGG - Intergenic
1108561190 13:51645951-51645973 CAGTAAGTGATTTTTGTGGAAGG - Intronic
1109250175 13:60010033-60010055 TAGTGTGTGCTTTATGCTCAAGG + Intronic
1111405335 13:87796692-87796714 TAGAATGTGCCTTATTTGGGGGG - Intergenic
1111602929 13:90496253-90496275 TATAATGTGCTTTCGGTGGAGGG - Intergenic
1112169860 13:96960005-96960027 TTGTTTGTGGTTTATGTGGTTGG + Intergenic
1112702041 13:102021072-102021094 GTGTATGTGCCTTAAGTGGAGGG + Intronic
1112993206 13:105539541-105539563 TACTAAGGGCTTTATGAGGAAGG - Intergenic
1114143401 14:19943556-19943578 TAGTATTTGCTTTATATGTCTGG - Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1115690017 14:35833175-35833197 AAGTAAGTGTTTTATGTTGATGG + Intronic
1116241289 14:42346496-42346518 TATTATATGCTTCATGTGAAAGG + Intergenic
1118478392 14:66140567-66140589 TAGTACTTGTTTGATGTGGATGG + Intergenic
1119691286 14:76674683-76674705 TGGAATGTGCTTTAAGTGGGTGG - Intergenic
1122006576 14:98709550-98709572 TATTAAGTGCTTTTTCTGGAAGG + Intergenic
1123166065 14:106325988-106326010 TAGTATGTGTTTTATTTGTGTGG + Intergenic
1123168765 14:106351021-106351043 TAGTATGTGTTTTATTTGTGTGG + Intergenic
1123192898 14:106588062-106588084 TAGTATGTGTTTTATGTGTGTGG + Intergenic
1123895414 15:24824236-24824258 TAGTTTGTTCTTATTGTGGAAGG + Intronic
1124596371 15:31095169-31095191 TAGTTTGTGCTTTGTCTGTATGG - Intronic
1124692137 15:31832695-31832717 TAGTATGTGTTTTTTGTGACTGG + Intronic
1127153410 15:56103055-56103077 TAATATGGGCTTTAAATGGATGG + Intronic
1127403551 15:58616120-58616142 TAGTATTTGCTTTATGTATCTGG - Intronic
1129688438 15:77699497-77699519 TAGTATGTGCTTATTGTGTGTGG - Intronic
1129688454 15:77699713-77699735 TAGTATGTGCTTATTGTGTGTGG - Intronic
1130374444 15:83315759-83315781 TAGTTTGTTTTTTCTGTGGAGGG + Intergenic
1139004694 16:62556051-62556073 TAATATTTGCTTTATGTGTCTGG + Intergenic
1140016230 16:71188610-71188632 TAATTTCTGCTTTATATGGATGG - Intronic
1140236239 16:73161454-73161476 GATTATGTGCTATTTGTGGAAGG + Intergenic
1140956398 16:79870479-79870501 TGCTATGTGTGTTATGTGGAAGG + Intergenic
1143932981 17:10450432-10450454 AAGTATGTGCTTTTAGTGCAGGG - Exonic
1144394584 17:14831956-14831978 TAATATGTGATTTATAAGGAAGG - Intergenic
1144655056 17:17029931-17029953 GAGTTTCTGCTTTATGTGGAGGG - Intergenic
1145065439 17:19758431-19758453 TTGTATGTGATTTTTGTGGATGG - Intergenic
1148489337 17:48013067-48013089 TAGTGTGTGTGTGATGTGGAGGG - Intergenic
1152514269 17:80813432-80813454 GTGTGTGTGCTTTATGTGTAAGG + Intronic
1153951260 18:10059719-10059741 TAGTGTGGGAATTATGTGGATGG + Intergenic
1156558455 18:38093812-38093834 TAGAATGAGCTATATGTGTAAGG + Intergenic
1157400316 18:47381818-47381840 TAGGATGTAATCTATGTGGAAGG + Intergenic
1158758350 18:60353538-60353560 TATTATGTCGTGTATGTGGAGGG - Intergenic
1158812000 18:61048557-61048579 TAATATGTGCTGTATTTGGGAGG + Intergenic
1159827403 18:73230890-73230912 TAGTATATGTTTAATGTAGAAGG - Intronic
1161646098 19:5454421-5454443 GAGTGTGGGCTTTATCTGGAGGG + Intergenic
1163578287 19:18123310-18123332 GAGAATGTGCTTGATGAGGAAGG + Exonic
1165354966 19:35298943-35298965 TAGTGTGTGGTTTTTGTGTATGG - Intronic
927955663 2:27205757-27205779 TAGTATGTTCTTAGGGTGGATGG - Intronic
928793219 2:34984319-34984341 TAAAATGTGCTTTGTTTGGATGG + Intergenic
929243878 2:39681247-39681269 TAATGTCTGCTTTGTGTGGAAGG - Intronic
931978873 2:67672999-67673021 TTGTATGTGCTGTATGTGTGTGG - Intergenic
933000158 2:76911921-76911943 TGGTATGTGCTTTTTGGGGGGGG + Intronic
933462429 2:82605536-82605558 TAGTATGTGCTGTGTATGGAGGG + Intergenic
933498305 2:83079387-83079409 TTGTATGTGTTTTGTGGGGACGG + Intergenic
937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG + Intergenic
938013314 2:127846535-127846557 CAATAAGTGCTTTATTTGGAAGG - Exonic
938045658 2:128117407-128117429 TAGAATTTGCTTTATGTGAAAGG + Intronic
938259545 2:129885306-129885328 TTATAAGTGCTTTACGTGGATGG - Intergenic
940226410 2:151406041-151406063 TAATGTGTGCTTAATGTGGCTGG + Intergenic
940940501 2:159555048-159555070 TGGTATGTGGTGTATGTGGGGGG + Intronic
943066693 2:183094329-183094351 TAATATGTGCTTTGGGTAGAGGG + Intronic
943458634 2:188141042-188141064 GATTGTGTGCTTTTTGTGGACGG - Intergenic
943602288 2:189936780-189936802 TAGTATGTAGTTTCTGTGTAAGG - Intronic
943882791 2:193168937-193168959 TAGTATATGCTTTATATGCTTGG - Intergenic
945273790 2:207968090-207968112 TAGTATGTGCATTGTTTTGAGGG + Intronic
1168878767 20:1188591-1188613 TAGTATGTGTATTGTGTGTATGG - Intronic
1169705596 20:8500847-8500869 TAATATGAGATTTATGAGGAAGG + Intronic
1173729463 20:45318254-45318276 CAGTCTGTGCTTTATAGGGAAGG + Intergenic
1177290987 21:19111101-19111123 CAGGATGTGCTTTGTGTGCATGG + Intergenic
1178498705 21:33108706-33108728 TAGAATGTTCTTTATGGGGGAGG - Intergenic
1178893449 21:36539997-36540019 TAGTATGTGATGTATGTGTGTGG + Intronic
1179039518 21:37789878-37789900 TAGTCTGTGGTTTGAGTGGAAGG + Intronic
1179578890 21:42325699-42325721 GAGTCTGTCCTGTATGTGGATGG - Intergenic
1182748357 22:32622862-32622884 TAGCTTGTGTTTTATGTAGAAGG + Intronic
1183330802 22:37220225-37220247 GAGTAGGTGCTATGTGTGGAAGG + Intergenic
1185044376 22:48521868-48521890 CAGGATGAGCTTCATGTGGAGGG + Intronic
1203323420 22_KI270737v1_random:91346-91368 TAGGATGTGCTTTATTTAGAAGG - Intergenic
949130527 3:494964-494986 TAGTATGTAATTTACATGGATGG - Intergenic
951783988 3:26397779-26397801 GAGTTTGTGCTTTTTGTGGGAGG + Intergenic
951807630 3:26664019-26664041 TAGTGTGGGCTTTATTTGGTGGG - Intronic
954520943 3:51225738-51225760 ATGTATGTGCTTTATGCAGATGG + Exonic
955117803 3:56023296-56023318 GAGTTTGGGCTTTATGTGGGGGG - Intronic
955419840 3:58725165-58725187 TACCATGTCCTTTATGTGCAAGG + Intronic
956208115 3:66775048-66775070 TAGTATGTATTTTTTGTGTAAGG - Intergenic
958446957 3:94227222-94227244 TGTTATGTGCTTTTTGTGGGAGG + Intergenic
959768417 3:110062582-110062604 TAGTATATCATTTTTGTGGAGGG - Intergenic
959806408 3:110559748-110559770 TAATATCTGCTTTATATGCAGGG + Intergenic
959904991 3:111701541-111701563 GAGTTTGAGCTTTATTTGGAAGG + Intronic
960304126 3:116040445-116040467 TTATGTGTGCTTTATGTAGAGGG - Intronic
962483595 3:135819344-135819366 TAATATGTGCTTTATATATACGG - Intergenic
964191149 3:154002506-154002528 TAGTATGTTCTTTATATGTGAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965384167 3:168025878-168025900 TAGGATGTGTATTATTTGGAAGG - Intronic
965719613 3:171647209-171647231 TATTATTTGCTTTAGGAGGATGG + Intronic
966753279 3:183343254-183343276 TAGTATTTGCTCTCTATGGAAGG - Intronic
967364091 3:188665925-188665947 TAGCCTGTGCTTTATCTGGCAGG + Intronic
967639366 3:191842517-191842539 TGGTATGGGCTTGATGTTGATGG + Intergenic
967660219 3:192098358-192098380 TAGGATCTGCTTGAGGTGGAAGG + Intergenic
971089259 4:23321301-23321323 CAGAATGTGGTTTATGTGTATGG + Intergenic
971119900 4:23691513-23691535 TAGTATGTACTTTATGCTTATGG - Intergenic
971683138 4:29727752-29727774 TTGTGTGTGCTTTGTGTGTAAGG - Intergenic
973240900 4:47954714-47954736 AAGTATGTTCTTTAAGTGGCTGG - Intronic
973535437 4:51877035-51877057 AAGTATGTCATTTTTGTGGAAGG + Intronic
974493773 4:62601211-62601233 TAGCATGTGGTTGATATGGAAGG + Intergenic
974522236 4:62996601-62996623 TGGTATGTTCTTTTTGAGGAAGG - Intergenic
975331225 4:73116107-73116129 TATTATGTACTTTTTTTGGAGGG - Intronic
977312815 4:95408249-95408271 TACTATGTGCTTTAAATGGCTGG + Intronic
980032614 4:127847938-127847960 TAGTATTTGCTTGATGAGGCTGG - Intergenic
982549544 4:156780604-156780626 TTGTATGTGCCTTGAGTGGAAGG + Intronic
983463288 4:168054039-168054061 TTGTATGTGATTTATATGAAAGG - Intergenic
986072404 5:4298465-4298487 TAGAATGTGTTTAATGTGTAAGG - Intergenic
986309507 5:6541898-6541920 GAGTATCTGCTTGATGGGGATGG + Intergenic
988050935 5:26030282-26030304 TAGCCAGTTCTTTATGTGGAAGG + Intergenic
991664885 5:68989675-68989697 TACTTTGTTCTGTATGTGGAAGG - Intergenic
994028971 5:95118873-95118895 TAGTATTTGCTTTATATGTCAGG - Intronic
995684498 5:114757414-114757436 TAGTATATTCTACATGTGGAAGG + Intergenic
995979219 5:118081177-118081199 TAGGATTTGCTTTATGTGACAGG + Intergenic
996878027 5:128261473-128261495 TAGTTTTTGATTTATGTGGGAGG - Intronic
997737672 5:136226006-136226028 TAGCATGTGGTTTATGAGGCTGG - Intronic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1004758850 6:18643438-18643460 TTGCATGTGCTGTATGTGGTAGG + Intergenic
1005656128 6:27939424-27939446 AGGTGTTTGCTTTATGTGGAAGG + Intergenic
1007324320 6:41048612-41048634 GAGTCGGTGCTTTATGTGCAGGG - Intronic
1007688961 6:43685796-43685818 TAGTCTATGCATTATGTGTAAGG - Intronic
1010559357 6:77329804-77329826 TAGTATGTGCTAAATTTGAAAGG - Intergenic
1012544327 6:100400103-100400125 TAGTTTTTGCTTCATGTAGATGG - Intronic
1012806868 6:103905724-103905746 TAGTATTTGCTTTATATGTCTGG + Intergenic
1013055811 6:106581918-106581940 AAGTAAGTGCTTCATGTGGTTGG - Intronic
1013834736 6:114320721-114320743 TTGTATCTGCTTTATGTGTAGGG + Intronic
1014075768 6:117232639-117232661 TAGTTTGTGCTTTAGGTTTATGG - Intergenic
1014976699 6:127893850-127893872 TATTTTTTGTTTTATGTGGAAGG - Intronic
1015000748 6:128211543-128211565 TATTATTTGCTTTATTTGTAAGG + Intronic
1015126456 6:129760566-129760588 TAGTCTGTCCTTCATCTGGAAGG - Intergenic
1016116560 6:140292358-140292380 TAATATTTGCTTTATGTGGCTGG - Intergenic
1018278088 6:162154082-162154104 TAGAATGAGCTTTATGCTGATGG - Intronic
1024230401 7:47359284-47359306 AAGTATGTGCTTTTTGTGGCTGG - Intronic
1027589998 7:80106627-80106649 TAGAAACTGTTTTATGTGGAGGG + Intergenic
1030839339 7:114328857-114328879 TAGTATGTGCATTATTTCAAGGG - Intronic
1035114301 7:156509916-156509938 TAGTACATGTTTTCTGTGGAGGG - Intergenic
1038819856 8:30942426-30942448 TATTATGCACTTTGTGTGGAGGG - Intergenic
1042041243 8:64592487-64592509 TAGTATGTTCTTGAAGGGGAAGG + Intronic
1042233422 8:66582835-66582857 TAGTATTTGCTTGATGTAGCTGG - Intronic
1042379117 8:68092604-68092626 TAGGATGTTTTTTATTTGGAGGG + Intronic
1042599672 8:70486550-70486572 TAGTAGGTGCTTTATATGCATGG - Intergenic
1043101231 8:76049051-76049073 TCATATGGGCTTTCTGTGGAGGG + Intergenic
1047063112 8:121250303-121250325 TAGTATGTGATTTATAGGCAGGG + Intergenic
1047825877 8:128574547-128574569 TAATATGCCCTTGATGTGGAAGG + Intergenic
1048723195 8:137351321-137351343 TAGTATTTTCTTTATGTATATGG + Intergenic
1050143442 9:2540338-2540360 AAGCATGTGCTTTATTTTGAGGG - Intergenic
1051384958 9:16497759-16497781 TAGTATGTCCTTTATGTTGGTGG - Intronic
1051557080 9:18395966-18395988 TAGTCTGGCCTTTCTGTGGAAGG + Intergenic
1051786151 9:20745936-20745958 TAGTATATAGTTTATTTGGAGGG + Intronic
1052182950 9:25553153-25553175 TATTATTTGTTTTATGTGAAAGG - Intergenic
1058394315 9:104532827-104532849 TAGTATTTGCTTTATTTGCGAGG - Intergenic
1058861861 9:109124409-109124431 TGGTATGTGCGTTGTGTGTAAGG + Intergenic
1060922592 9:127432592-127432614 TGGTCTGTGCTTTATGAGGATGG + Intronic
1061318191 9:129810672-129810694 TAGGATGTGCTTGTTCTGGAAGG + Exonic
1186595265 X:10974429-10974451 GAGTCTGTGTTTTATTTGGATGG - Intergenic
1186859847 X:13661653-13661675 GATTATGTACATTATGTGGAGGG + Intronic
1186998885 X:15154756-15154778 TAGTATTTGCTTTTTTTGGTAGG - Intergenic
1187822525 X:23303275-23303297 TAGTATGTGTGTTTTGGGGAGGG - Intergenic
1188234011 X:27704333-27704355 TAGTATCTCCTTTATGAGGCTGG - Intronic
1188400006 X:29732576-29732598 AAGGATGTTCATTATGTGGAAGG - Intronic
1189019847 X:37323196-37323218 TAGTATTTGCTTTATATATATGG - Intergenic
1189606717 X:42685818-42685840 TAATATGTGCCTTATGTGTTAGG - Intergenic
1191926802 X:66320827-66320849 TAATATTTTCTTTATGTGTATGG - Intergenic
1193219673 X:78909431-78909453 TAGTATTTGCTTTATGTATCTGG + Intergenic
1193444269 X:81580019-81580041 TAGCATGTGCTTTTTGGGGGGGG - Intergenic
1194142699 X:90224104-90224126 CAGTATTTGCTTTCTGTGGCTGG - Intergenic
1194838042 X:98706247-98706269 TAATATGTGCTTTATGAGTCTGG + Intergenic
1195444814 X:104940308-104940330 TAATATGGGCTATATGTGGATGG + Intronic
1198437342 X:136630097-136630119 AAGTCTGTGCTTCTTGTGGATGG - Intergenic
1198542444 X:137654185-137654207 TATTCTGTGCTTTATATTGAGGG - Intergenic
1199698322 X:150359419-150359441 TAGCCTGTGCTTTACGTGCAGGG - Intergenic
1199843513 X:151674243-151674265 GGGTGTGTGCCTTATGTGGAAGG - Intronic
1200488456 Y:3793207-3793229 CAGTATTTGCTTTCTGTGGCTGG - Intergenic
1200767507 Y:7092717-7092739 TAATAAGTGCTTTATGTAGAAGG + Intergenic