ID: 1096720421

View in Genome Browser
Species Human (GRCh38)
Location 12:53517087-53517109
Sequence GCTCTTGGGCGGGCGAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096720411_1096720421 22 Left 1096720411 12:53517042-53517064 CCATGTCCAAGGCAGATGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 272
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62
1096720408_1096720421 30 Left 1096720408 12:53517034-53517056 CCATATTGCCATGTCCAAGGCAG 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62
1096720415_1096720421 16 Left 1096720415 12:53517048-53517070 CCAAGGCAGATGGGAGGGGATAA 0: 1
1: 0
2: 0
3: 19
4: 215
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096720421 Original CRISPR GCTCTTGGGCGGGCGAGCTC TGG Exonic