ID: 1096720421

View in Genome Browser
Species Human (GRCh38)
Location 12:53517087-53517109
Sequence GCTCTTGGGCGGGCGAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096720415_1096720421 16 Left 1096720415 12:53517048-53517070 CCAAGGCAGATGGGAGGGGATAA 0: 1
1: 0
2: 0
3: 19
4: 215
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62
1096720408_1096720421 30 Left 1096720408 12:53517034-53517056 CCATATTGCCATGTCCAAGGCAG 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62
1096720411_1096720421 22 Left 1096720411 12:53517042-53517064 CCATGTCCAAGGCAGATGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 272
Right 1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096720421 Original CRISPR GCTCTTGGGCGGGCGAGCTC TGG Exonic
900365168 1:2309024-2309046 GGACGTGGGCAGGCGAGCTCGGG + Exonic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
902527253 1:17067324-17067346 GCTCTGGGGCTGGAGAGATCTGG + Exonic
907124477 1:52037455-52037477 GCACTTGGGAGGCCGAGGTCGGG - Intronic
920509521 1:206540530-206540552 GCTCCTGGGCTGGCCAGATCAGG + Intronic
1063242756 10:4188212-4188234 GCTCTGGGACGGGAGAGCTGCGG + Intergenic
1063661914 10:8040275-8040297 GCTGTTGGGGGGGCGAGCTCTGG + Intergenic
1068637413 10:59362752-59362774 GCGCCTGGGCTGGCGAGGTCGGG - Intronic
1074530835 10:114297614-114297636 GCTCTTGGGGAGGAGAGCTCTGG + Intronic
1075710278 10:124527047-124527069 GCTCTGTGGCGGGCAGGCTCTGG - Intronic
1077038393 11:506580-506602 GGTCTTGGTCGTGCGAGGTCGGG - Intronic
1083476744 11:62920347-62920369 GCTCCTGGGCAGGCCAGCTGGGG - Intronic
1084652531 11:70497623-70497645 GCTCATGGGCTGGGGGGCTCTGG - Intronic
1084814672 11:71639268-71639290 GCTCTTGGCCAGGCCAGCTCCGG - Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1091284752 11:134402409-134402431 GCTCTAGGGCCAGCGAGCCCTGG + Intronic
1096672875 12:53210765-53210787 GGTCTTGGGTGGGGGAGCCCAGG - Exonic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1098161492 12:67650171-67650193 GGTCATGGGTGGGCGAGCTCTGG - Intronic
1102243634 12:111341549-111341571 GCTCCCGGGCGGGCGAGGTTAGG + Intronic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104767698 12:131341009-131341031 GGTCTGGGCCGGGCGAGCCCAGG + Intergenic
1107636998 13:42402348-42402370 GCTCAGGGGCTGGAGAGCTCTGG - Intergenic
1114224261 14:20723650-20723672 GCTCCAGGGCGGGCGCGCTCAGG - Intergenic
1118839273 14:69499026-69499048 GCTCTTGGGGGAGGGAGCTGAGG + Intronic
1122206530 14:100150512-100150534 GCTCTGGGGAGGGCCAGCCCAGG + Intronic
1122424638 14:101598817-101598839 GGTCTTGGGTGGGAGAGCACTGG - Intergenic
1124999389 15:34754818-34754840 TCTCCTGGGCGGGCGAGCGCTGG - Exonic
1129675957 15:77632561-77632583 GCGGATGGGCGGGCGCGCTCAGG + Intronic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1136517767 16:30778133-30778155 GCTCTGGCGCTGGCCAGCTCAGG - Intergenic
1140926551 16:79589720-79589742 GCCCTAGCGCGAGCGAGCTCCGG - Intronic
1142271876 16:89094047-89094069 GCTCTCGGGGGCGCGGGCTCCGG + Intronic
1148119869 17:45202186-45202208 GCTGTTGGGAGGGAGAGCTTTGG + Intergenic
1148733280 17:49850902-49850924 GCTCTGGCGCTGGCGAGGTCGGG - Intergenic
1148780709 17:50119852-50119874 GCTCTGGGGTGGGAGAGATCAGG - Intronic
1160131586 18:76230340-76230362 TCTCTTGGGCGTGGGAACTCCGG - Intergenic
1160707900 19:538246-538268 GCTCTTGGCCTGGTGAGCTCTGG + Intronic
1163636188 19:18438134-18438156 GCTCTCGGGCGCGCGACCTCCGG + Exonic
1164835256 19:31351488-31351510 GCTCTCGGGCTGGCGGACTCGGG + Intergenic
926319953 2:11742833-11742855 GCTGGTGGGCGGGGGAGCTCGGG - Intronic
926799417 2:16646492-16646514 GCTCTGGGGCAGGCAAGCTCAGG + Intronic
930453996 2:51581763-51581785 GCTCTTCCGCCGGCGTGCTCTGG - Intergenic
931440827 2:62289209-62289231 GCTCTTGGGCTGGTAAGCTCAGG - Intergenic
935300871 2:101693008-101693030 GCTCGTGGCCTGCCGAGCTCAGG + Intergenic
936082244 2:109440300-109440322 GCTCTTGGGCCGCCGAGGCCAGG + Intronic
937984240 2:127631443-127631465 GCTCTAGGGCAGGAGAGCCCAGG + Intronic
939984105 2:148813591-148813613 GCTCTTGTGCTGGCCAGCACAGG + Intergenic
949037087 2:241820927-241820949 GCCCTTGGCAGGGCCAGCTCCGG - Intergenic
1170810459 20:19670104-19670126 GCTCCAGGTCGGGCCAGCTCTGG - Intronic
1173941748 20:46916714-46916736 GCTTTTGGAGGGGAGAGCTCGGG + Intronic
1174269661 20:49358520-49358542 GCTCTTGGGGGGCAGAGCTCCGG + Intergenic
1175153613 20:56954587-56954609 GCTCTTGGGAGAGGGAGCTTTGG - Intergenic
1179169764 21:38963733-38963755 GCTCTTGGGTGGCCCAGCTGTGG + Intergenic
1179495012 21:41766234-41766256 GCGCTTGCGCGGTGGAGCTCCGG - Intronic
1182071220 22:27465086-27465108 GCTCCTGGGAGGCCAAGCTCAGG + Intergenic
1182126040 22:27816585-27816607 GCTCTTGAGAGGGTTAGCTCCGG - Intergenic
969053292 4:4387209-4387231 GCTCCTGGGCGGGCAAGGTCTGG - Intronic
975148317 4:70993794-70993816 CCTCTTTGCCGGACGAGCTCTGG + Exonic
982320162 4:154068788-154068810 TCTCATGGGCTGGAGAGCTCTGG + Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
985906557 5:2842179-2842201 GCTCTTGGGAGGGTCAACTCTGG + Intergenic
988450167 5:31334060-31334082 GCTCTTTGGAGGCCCAGCTCAGG - Intergenic
989257009 5:39376894-39376916 GTCCTTGGGAGGGCCAGCTCTGG + Exonic
1002332777 5:178455807-178455829 CCTGATGGGCGGGCGAGCTGAGG - Intronic
1012145177 6:95671161-95671183 GTTCTTGGTCTGGCTAGCTCAGG - Intergenic
1017633842 6:156424326-156424348 GCTCTTGCAGGGGCCAGCTCAGG - Intergenic
1018874154 6:167804956-167804978 GCTCCTGGAGTGGCGAGCTCTGG - Intergenic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1035780427 8:2223450-2223472 GCTCTTTGGGGGGCCAGCTGAGG + Intergenic
1049095436 8:140545616-140545638 GCTGTTGGGAGGGTGAGCACTGG - Intronic
1053001147 9:34577936-34577958 GCTGGCGGGCGGGCGAGCGCGGG + Intronic
1056287015 9:85098682-85098704 GCTCTTGAACTGCCGAGCTCAGG + Intergenic
1056773901 9:89497945-89497967 GCTCCCGGCCGGGCGAGTTCGGG + Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1061666765 9:132164540-132164562 GCTCTGGGCAGCGCGAGCTCGGG + Intronic
1062574691 9:137200683-137200705 GCCCTGGGGCGGCCGGGCTCGGG - Exonic
1192624614 X:72714348-72714370 GCCCCGGGGCGGGCGAGCCCCGG - Intergenic