ID: 1096721890

View in Genome Browser
Species Human (GRCh38)
Location 12:53529201-53529223
Sequence ATTTAGTTATTTATTTAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8403
Summary {0: 1, 1: 110, 2: 1437, 3: 2532, 4: 4323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096721888_1096721890 -3 Left 1096721888 12:53529181-53529203 CCCTGTCTCTAATATTATTTATT 0: 1
1: 1
2: 10
3: 137
4: 1511
Right 1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG 0: 1
1: 110
2: 1437
3: 2532
4: 4323
1096721887_1096721890 16 Left 1096721887 12:53529162-53529184 CCTGGGCAACATAGTGAGACCCT 0: 2754
1: 16967
2: 53422
3: 152002
4: 305017
Right 1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG 0: 1
1: 110
2: 1437
3: 2532
4: 4323
1096721886_1096721890 20 Left 1096721886 12:53529158-53529180 CCAGCCTGGGCAACATAGTGAGA 0: 8728
1: 47895
2: 121208
3: 309924
4: 360883
Right 1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG 0: 1
1: 110
2: 1437
3: 2532
4: 4323
1096721889_1096721890 -4 Left 1096721889 12:53529182-53529204 CCTGTCTCTAATATTATTTATTT 0: 1
1: 2
2: 12
3: 145
4: 1480
Right 1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG 0: 1
1: 110
2: 1437
3: 2532
4: 4323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096721890 Original CRISPR ATTTAGTTATTTATTTAAGA CGG Intronic
Too many off-targets to display for this crispr