ID: 1096725740

View in Genome Browser
Species Human (GRCh38)
Location 12:53560606-53560628
Sequence CCTCATGAAAACGGGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096725740 Original CRISPR CCTCATGAAAACGGGTGCTG TGG (reversed) Intronic
902584737 1:17431795-17431817 CCTCATGAAAAGGGGAAGTGAGG + Intronic
902992675 1:20200141-20200163 CCTCCTGAGAAGTGGTGCTGGGG - Intergenic
903377984 1:22878484-22878506 CCACATGATACGGGGTGCTGGGG - Intronic
908680828 1:66659283-66659305 CCTCATTAAGACAGGTGCTGAGG + Intronic
912035196 1:105303250-105303272 CCTCATGAAAACTGCTACAGAGG - Intergenic
912373527 1:109191839-109191861 CCTCATGAAAAGTGGTCCTCTGG - Exonic
912913539 1:113788337-113788359 CCACATAAAAAAGGGTGGTGGGG + Intronic
913278498 1:117162695-117162717 CCTCATGCAGACAGGAGCTGTGG - Intronic
919240545 1:194910358-194910380 CCACATAAAAACGGGTGCCTTGG - Intergenic
922609464 1:226914005-226914027 CTCCATGAAAAAGGGTTCTGTGG + Intronic
1063521325 10:6743857-6743879 CCTGCTGAAAACCTGTGCTGAGG - Intergenic
1071708030 10:88020630-88020652 CCTCATGAGAACTGGAGCTTGGG - Intergenic
1072978092 10:100076557-100076579 CTTCATGAAAACAGGTTCTGGGG - Intronic
1074417827 10:113282886-113282908 CCTCATTAAAAGGGGTGGCGAGG + Intergenic
1077287154 11:1772768-1772790 CCTCAAGAGAAAGGGGGCTGCGG + Intergenic
1079322632 11:19464154-19464176 CGTGATGGAAACGGGTGCTCTGG - Intronic
1079443052 11:20534529-20534551 CCTCATGAAAACAGGTGAGCTGG - Intergenic
1083500743 11:63105381-63105403 CCTCATGAAAACCTCTGCTAGGG - Intronic
1083945746 11:65921615-65921637 CCACATGAAACTGGGAGCTGGGG + Intergenic
1084191182 11:67499674-67499696 CCTGCTGTACACGGGTGCTGGGG + Intronic
1084542704 11:69797449-69797471 CCTCATGGACAGGGGAGCTGCGG + Intergenic
1087057699 11:93949736-93949758 CCTCCTGAGGACTGGTGCTGTGG - Intergenic
1088699998 11:112403262-112403284 CCATATGAAAAAGGCTGCTGTGG + Intergenic
1089046847 11:115508535-115508557 CCTTTTGAAAACGGCAGCTGAGG - Intergenic
1092199770 12:6573158-6573180 CCTCAGCAAAGCGGGTGTTGAGG + Exonic
1096725740 12:53560606-53560628 CCTCATGAAAACGGGTGCTGTGG - Intronic
1099950135 12:89292792-89292814 CTTAATGAAAGCGGGTGTTGTGG + Intergenic
1105644544 13:22303200-22303222 CCTCATGAGAACCTGTGCTAGGG - Intergenic
1108596068 13:51950621-51950643 CCTCATGAAGACAAGTTCTGTGG + Intronic
1118547456 14:66907647-66907669 CCTCATGGAAGCGGGTGGAGGGG + Intronic
1123457933 15:20442964-20442986 CCTCATGAAAAGGGGAGATTTGG + Intergenic
1123660135 15:22557445-22557467 CCTCATGAAAAGGGGAGATTTGG - Intergenic
1124313996 15:28651940-28651962 CCTCATGAAAAGGGGAGATTTGG - Intergenic
1125499982 15:40233658-40233680 CCTCAGGAAAACGGGTTTTCAGG - Intergenic
1136075863 16:27816890-27816912 CCTCATGGAAAGTGGGGCTGGGG + Intronic
1142181655 16:88674127-88674149 CCTCCTGGAAACAGGTGTTGAGG - Intergenic
1147236562 17:39061923-39061945 CCTCAGATAAACGGGTGCTGAGG + Intergenic
1147293438 17:39461889-39461911 CCTCATGTAGAAGGGTGCTGAGG + Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
925182609 2:1826890-1826912 CCTCATGAGAGCAGGTGGTGGGG + Intronic
925195591 2:1922237-1922259 CCTCATGAAAACATGAGCTAGGG - Intronic
927859510 2:26551572-26551594 CCTCATGATGATGGGTGCAGTGG + Intronic
931781616 2:65583444-65583466 TCTCATGGAAACGAGTGGTGAGG - Intergenic
932666936 2:73705546-73705568 GGTCCTGAAAACGTGTGCTGGGG + Intergenic
934988964 2:98907895-98907917 CCAGATGAAAAAGGGTGATGAGG + Intronic
939190729 2:138913933-138913955 CCTCATGACTATGGGTACTGGGG - Intergenic
940941975 2:159572012-159572034 CTTGATGAAAACTGGTGCTGTGG - Intronic
941538737 2:166756311-166756333 CCCCATCACAAGGGGTGCTGAGG + Intergenic
943655887 2:190508535-190508557 TCTCATGAAAAAGAGTTCTGTGG + Exonic
948922056 2:241070482-241070504 TCACCTGAAAACGGGTGCCGAGG + Intronic
1174867622 20:54152463-54152485 CCTAATGAATCCCGGTGCTGGGG + Intergenic
1178603801 21:34017631-34017653 TCTCATGTAAAGGGCTGCTGTGG - Intergenic
1184087267 22:42272348-42272370 CCTCCTGAAGACTGGTGTTGGGG + Intronic
952794471 3:37226745-37226767 ATTCATGAAAAGGGGTTCTGTGG + Intergenic
953958171 3:47247260-47247282 CCTCATGTGAATGGGTGCAGTGG - Intronic
956796774 3:72724934-72724956 CCTCAAAAAACCGGGTGCGGTGG + Intergenic
961367022 3:126406586-126406608 CCTGAAGAAACAGGGTGCTGGGG + Intronic
968476080 4:809441-809463 CCTCAAGGAAACGGGCCCTGTGG + Intronic
968689004 4:1980474-1980496 CCCCTTGAAAACTGCTGCTGAGG + Exonic
972493229 4:39608056-39608078 CCTCATGTAAAATGGTGGTGTGG + Intronic
985703196 5:1386006-1386028 CCTCATGGAACGGGGTGCAGTGG + Intergenic
985731350 5:1550770-1550792 CATCATGAGAACTGGGGCTGAGG + Intergenic
990936820 5:61160183-61160205 TCTTATGAAAACTGGGGCTGGGG + Exonic
997237882 5:132284538-132284560 TCTAATGCAAAAGGGTGCTGTGG + Intronic
1004776499 6:18851942-18851964 CCCCATGAAAGCAGGTTCTGAGG + Intergenic
1007078403 6:39082416-39082438 CCTCAGGGAAGCAGGTGCTGGGG + Intronic
1012940379 6:105409160-105409182 CCTCATGATAGCGAGTTCTGAGG - Intergenic
1019312121 7:367962-367984 CCTCATGAAGAAAGGGGCTGTGG + Intergenic
1020687734 7:11316372-11316394 CTTCATAAAAACAAGTGCTGTGG + Intergenic
1024581757 7:50806298-50806320 CCTCATGAAAGCCAGTGATGAGG - Intergenic
1026681574 7:72471246-72471268 CCTCATGAAAAGGAATTCTGGGG - Intergenic
1027271157 7:76519687-76519709 CCCCAGGAAAAGGGGTTCTGGGG + Intergenic
1027320921 7:77009622-77009644 CCCCAGGAAAAGGGGTTCTGGGG + Intergenic
1032334345 7:131011331-131011353 CCCTATGAAAAAGGATGCTGTGG - Intergenic
1032707010 7:134429701-134429723 CCTCAGCAAAACGAGTTCTGGGG + Intergenic
1034196663 7:149253704-149253726 CCTCTTGGAAACAGGTCCTGGGG + Exonic
1034684144 7:152954945-152954967 CTTCATGAACACGAGTGCTCTGG + Intergenic
1048364048 8:133722874-133722896 CCTTATGAAAACAGGGACTGTGG + Intergenic
1049702549 8:144021724-144021746 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702603 8:144021950-144021972 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702649 8:144022126-144022148 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702755 8:144022571-144022593 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049703359 8:144024792-144024814 CCTCAGGGAAGAGGGTGCTGAGG - Intronic
1049703369 8:144024824-144024846 CCTCAGGAAAGAGGGTCCTGAGG - Intronic
1049703414 8:144024983-144025005 CCTCAAGAAAAAGGGTCCTGAGG - Intronic
1051391578 9:16570562-16570584 CCTCATAAAAACGGGTTAAGAGG + Intronic
1056863934 9:90213050-90213072 CCTCCTGATAACGGGTGACGGGG - Intergenic
1057823999 9:98358502-98358524 CCTCATGGTACAGGGTGCTGTGG - Intronic
1061441773 9:130609514-130609536 CCTCATGACTACAGCTGCTGTGG + Intronic
1186327460 X:8495131-8495153 CTTCATGAAAACAGGTGAGGAGG + Intergenic
1186498029 X:10027680-10027702 TCACATGAAAAGGGGAGCTGTGG + Intronic
1189220958 X:39371472-39371494 CCTCAAGAAAACAGAGGCTGAGG + Intergenic
1189376780 X:40472662-40472684 TCTCATGGAAGCAGGTGCTGAGG - Intergenic
1196682508 X:118483351-118483373 CCTAGTGAGATCGGGTGCTGTGG - Intergenic
1201772117 Y:17625112-17625134 CCTCATGAAGGGGTGTGCTGAGG + Intergenic
1201829438 Y:18280874-18280896 CCTCATGAAGGGGTGTGCTGAGG - Intergenic