ID: 1096736571

View in Genome Browser
Species Human (GRCh38)
Location 12:53660197-53660219
Sequence ATCTCCCAACATCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096736571_1096736578 -3 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736578 12:53660217-53660239 GATGGGAGTGGAAAAGCCATGGG 0: 1
1: 0
2: 4
3: 23
4: 246
1096736571_1096736579 -2 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736579 12:53660218-53660240 ATGGGAGTGGAAAAGCCATGGGG 0: 1
1: 0
2: 3
3: 26
4: 257
1096736571_1096736581 8 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736581 12:53660228-53660250 AAAAGCCATGGGGATACAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 296
1096736571_1096736580 7 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736580 12:53660227-53660249 GAAAAGCCATGGGGATACAGAGG 0: 1
1: 0
2: 1
3: 30
4: 305
1096736571_1096736577 -4 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736577 12:53660216-53660238 AGATGGGAGTGGAAAAGCCATGG 0: 1
1: 0
2: 1
3: 37
4: 384
1096736571_1096736584 26 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736584 12:53660246-53660268 GAGGGGTTACAAGTCTGTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 116
1096736571_1096736582 9 Left 1096736571 12:53660197-53660219 CCCTACTCCAGATGTTGGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1096736582 12:53660229-53660251 AAAGCCATGGGGATACAGAGGGG 0: 1
1: 0
2: 5
3: 26
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096736571 Original CRISPR ATCTCCCAACATCTGGAGTA GGG (reversed) Intronic
901802335 1:11715492-11715514 ATCTCCCACTATCTGGAAGAGGG + Intronic
901889329 1:12248757-12248779 ATGTCCCCACATCTGGACCAAGG - Intronic
904108441 1:28106047-28106069 ATCTCCCAGAATCAGGAGTTTGG + Intergenic
908040240 1:60104886-60104908 ATCTCCCAGCATCTTGAGGTAGG + Intergenic
913204887 1:116529265-116529287 ATCTCTGAACATCTGTAGCATGG + Intronic
914861658 1:151391339-151391361 AACTCCCAAGTTCTGGAATAGGG - Intergenic
916858795 1:168780313-168780335 ATCTCCCATCCCCTGGACTAAGG + Intergenic
917483599 1:175434400-175434422 CTCTCCAACCATCTGGAGAATGG - Intronic
917948402 1:180001797-180001819 CTCTCCCTAAATCTGGAGAAGGG + Intronic
918146934 1:181765284-181765306 TTCTCCCTACATTGGGAGTAGGG + Intronic
918727462 1:187943639-187943661 ATCTGCCAGCATCTTGATTATGG + Intergenic
921435688 1:215118184-215118206 AGCTCACATCATCTGGAATAAGG + Intronic
922861601 1:228822569-228822591 GTCTCACAACTTCTGGTGTATGG + Intergenic
924909032 1:248489099-248489121 ATCTCCCAGGATCTGCAGAAGGG - Exonic
924915073 1:248558959-248558981 ATCTCCCAGGATCTGCAGAAGGG + Exonic
1064099938 10:12454784-12454806 ATCTGCAAACCTCTGGAGAATGG + Intronic
1067233026 10:44425340-44425362 AAGTCCCAGCATCTGGGGTAGGG - Intergenic
1071215910 10:83401124-83401146 ATCTCTCAACAACTGGAGCTTGG - Intergenic
1073151577 10:101315166-101315188 ATCTCCATATATCTGGAGTCTGG + Intergenic
1075502368 10:122987183-122987205 ATTCCCCAGCATCTAGAGTAAGG - Intronic
1075955190 10:126517518-126517540 CTCTCCCAATAGCTGGGGTATGG - Intronic
1078325404 11:10376563-10376585 ATCTCCCAACATCTCAATGAAGG - Intronic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1082781921 11:57294656-57294678 CTCTGCCAACATCTGGGGAATGG - Intergenic
1083843351 11:65316817-65316839 TTCTCCCCACATCTGGAATTGGG + Intronic
1088343012 11:108790173-108790195 ACCTTACATCATCTGGAGTAGGG - Intronic
1088808221 11:113370744-113370766 ATCTCCCCAGTTCTGGAGCAGGG + Intronic
1091419000 12:318366-318388 ATCTATCAACATCTGGAGTTTGG + Exonic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1091642797 12:2250294-2250316 ACCTCCCAGCACCTGGAGTTGGG + Intronic
1092330622 12:7583743-7583765 ACCCCCCAGCATCTGGAGGAGGG + Intergenic
1093425489 12:19023913-19023935 ATCTCCCAACCTCTGGGAAATGG + Intergenic
1096736571 12:53660197-53660219 ATCTCCCAACATCTGGAGTAGGG - Intronic
1099337898 12:81387784-81387806 AGCACCCAAGATCTGGATTAGGG - Intronic
1100050577 12:90444138-90444160 TTATCCCAACCTCTGGAGTTGGG - Intergenic
1100309435 12:93380119-93380141 AGAGCCCAACATCAGGAGTAAGG - Intronic
1100791741 12:98137642-98137664 ATCTCCCAAGAGCTGGACAAGGG + Intergenic
1103828319 12:123758427-123758449 ATTTTCCAACAGCTGAAGTAGGG + Exonic
1104364036 12:128160829-128160851 ATCTCCTAGCATCTGGAATTGGG - Intergenic
1109525531 13:63569442-63569464 ATCCCACAAAATGTGGAGTATGG - Intergenic
1110674962 13:78231086-78231108 AATTTCCTACATCTGGAGTAGGG + Intergenic
1111198551 13:84904959-84904981 AGCTCCCAAGATCTTGAGGAGGG - Intergenic
1115683355 14:35766783-35766805 AACTCCCACCACCTTGAGTAAGG + Intronic
1116808986 14:49521236-49521258 ATGTCCCATTTTCTGGAGTATGG - Intergenic
1117656568 14:57961958-57961980 ATTACCCAACACCTGGAGCAGGG + Intronic
1120289347 14:82547057-82547079 ATCTCCCAAGATTTTCAGTATGG + Intergenic
1122242461 14:100377901-100377923 ATCCCCCAACAGGTGGAGTCAGG - Intronic
1130550777 15:84888847-84888869 ATCACCTACCATCTGGAGAAGGG - Exonic
1132075420 15:98816006-98816028 ACCTCCCCACAGCTTGAGTATGG - Intronic
1132075653 15:98817777-98817799 ATCTCCCCAGAGCTTGAGTATGG - Intronic
1146027435 17:29333619-29333641 ATTTCCCAACCTCTGCACTATGG + Intergenic
1152268390 17:79309500-79309522 GTCACCCAACACCTGGAGGAGGG - Intronic
1152321810 17:79611940-79611962 CTCCCCCAGCATCTAGAGTAAGG + Intergenic
1154198408 18:12282463-12282485 ATCCCCCAACCTCTGGGGAAGGG + Intergenic
1156714073 18:39985091-39985113 TTCTCCTAAGATCTGGAATAAGG + Intergenic
1156754176 18:40500777-40500799 ATTTCCAAACATCTGGACTTTGG - Intergenic
1157208157 18:45718053-45718075 TTCTCCCAACACCTGGACCAAGG - Intergenic
1163066970 19:14804229-14804251 ATCTCCCAACCTTTGCAGTTTGG - Intronic
1165146933 19:33736744-33736766 GACTCCCAACGTCTGCAGTATGG - Intronic
1166365632 19:42276993-42277015 ATCTCCCAACCTCTAGACTGTGG + Intronic
1167800371 19:51736824-51736846 ATCTCTCAACATTTGGAAAATGG - Intergenic
930075480 2:47402652-47402674 AACTGCCAACATCGGGATTACGG - Intergenic
930266187 2:49202195-49202217 CTCTGCCAACACCTGGAGTTAGG - Intergenic
932940277 2:76156377-76156399 ATTTACCAACCTCTGGAATAGGG + Intergenic
935199545 2:100844293-100844315 CTCTCCCAACATCCTGGGTAAGG - Intronic
936853112 2:116925355-116925377 ATCTCCCAATATTTAGAGCAGGG - Intergenic
940020217 2:149148394-149148416 CTCCCCCAACATCTGTAGTTTGG - Intronic
941014786 2:160342979-160343001 ATCTCCCATGAACTGGAATAAGG + Intronic
946849067 2:223887376-223887398 ATCTCCAAACAACTTCAGTAAGG + Intronic
1172444014 20:34983896-34983918 GGCTCCCAGCATCCGGAGTAGGG + Intronic
1177794841 21:25763810-25763832 ATCTGGCAATATCTGGAGTAAGG - Intronic
1178232254 21:30799611-30799633 TTCTTCCAGAATCTGGAGTAGGG - Intergenic
951548824 3:23856428-23856450 TTCTCTCCCCATCTGGAGTATGG + Intronic
953459607 3:43072126-43072148 GTCTCCAAACATCTGGAATGTGG - Intergenic
954122777 3:48509669-48509691 ATCTCCCAAACTCTGGGGAACGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956380285 3:68657877-68657899 ATCTCACAACATCTTTATTAGGG + Intergenic
961889821 3:130121483-130121505 GTCTCCCACCACCTGGAGAAGGG - Intergenic
961925556 3:130475975-130475997 CTTTACCAACATCTGGAGGAAGG + Intronic
964305633 3:155336496-155336518 CTATCCCAACATCTGGGGAAGGG - Intergenic
965616498 3:170598381-170598403 ATCTCATAATATCTGGAGTATGG + Intronic
976077078 4:81312048-81312070 CTCTCCCTTCATCTGGAGCAGGG - Intergenic
979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG + Intergenic
979582642 4:122378836-122378858 ATCACCTAACACCTCGAGTAGGG + Intergenic
981015126 4:139966375-139966397 AGTTCCTAACATCTGGAGAATGG - Intronic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
983928313 4:173426403-173426425 ATCTACTTACACCTGGAGTAGGG - Intergenic
985231930 4:187827811-187827833 ATCACACATCATCTGGAGGATGG - Intergenic
985752588 5:1689554-1689576 TTCTACCAACATCAGGAGTGGGG + Intergenic
986022282 5:3815517-3815539 ATATCCTCACATCTGGAGTTAGG + Intergenic
989381145 5:40810551-40810573 ACCTCCCAACCTCTGGAGAGGGG - Intergenic
993482748 5:88445032-88445054 ATCTTCAAACACCTGGATTATGG - Intergenic
994351537 5:98752073-98752095 TATTCCCAACATCTAGAGTAGGG - Intergenic
995029469 5:107464154-107464176 ACCTCCTAACCTCTGGAGTCTGG + Intronic
995039784 5:107574497-107574519 ATCTGCTACCATCTGGAGAATGG - Intronic
1000401479 5:160833000-160833022 ATGTGCCAAACTCTGGAGTAGGG + Intronic
1000614148 5:163409366-163409388 ATCTTCCTACATCTGGACAAGGG - Intergenic
1001290428 5:170453877-170453899 TTCTGCCAACATCCTGAGTAAGG + Intronic
1012806353 6:103898611-103898633 ATCTCCAAAAATCAGGAATAAGG + Intergenic
1013643965 6:112117211-112117233 ATGTCCCATCATCTGGCATAGGG + Intronic
1013664437 6:112332595-112332617 ATCCCCCAACATCCGGAGTCAGG + Intergenic
1013768782 6:113603684-113603706 ATCTTCCTGCATCTGGAGGAGGG - Intergenic
1014161338 6:118172223-118172245 ATCTTCCAACATTTGGATTTTGG + Intronic
1016013159 6:139159228-139159250 ATCTCCCACAGTCTGGAGTCGGG + Intronic
1017367981 6:153667642-153667664 ATCTCCCTAGTTCTGGAGTCGGG - Intergenic
1017511715 6:155120030-155120052 ACATCCCAACATCTGCAGCATGG - Intronic
1018937056 6:168280233-168280255 ATCTCCCAACCTCTGTAGGAGGG - Intergenic
1019295915 7:274844-274866 CTCTCCCCACATTTGGAGCAGGG + Intergenic
1022827636 7:34032410-34032432 ATCACCCATTATCTGGAGTATGG + Intronic
1029870386 7:103685056-103685078 ATCTGCCAAAATTTGGAGGAGGG - Intronic
1031281121 7:119800523-119800545 TTATGCCAACCTCTGGAGTAGGG - Intergenic
1031962645 7:128003848-128003870 AGCTCCCTACCTCTGGAGTGAGG + Intronic
1032017510 7:128389311-128389333 CTCTCCTCACATCTGGAGTCAGG - Intergenic
1032027941 7:128458058-128458080 ATCTCCCAACAGCTGAAGTTGGG - Exonic
1032415836 7:131734754-131734776 CTCTACCAGCCTCTGGAGTAGGG - Intergenic
1033527378 7:142229926-142229948 ATCTCCCAACATTTGCTTTAAGG - Intergenic
1040289500 8:46117108-46117130 AACCCCCAAGCTCTGGAGTAGGG - Intergenic
1044106488 8:88213893-88213915 ATTTCCAAACATTTGGAATATGG - Intronic
1050161867 9:2727511-2727533 TTCTCCCAACTTCTGGACCAAGG - Intronic
1058399571 9:104598999-104599021 ATATCCCATCATCATGAGTAAGG - Exonic
1058400034 9:104605213-104605235 ATATCCCATCATCATGAGTAAGG - Exonic
1060745119 9:126126166-126126188 AGCTCCCAGCTTCTGGAGAAAGG + Intergenic
1060986884 9:127825173-127825195 AACTCCCAACCTCTGGATCAGGG - Intronic
1061095327 9:128453550-128453572 ATCTCCAAAAATGTGGAGCATGG - Intergenic
1186750704 X:12619095-12619117 TTCTCCCAACATCTGTAATAGGG + Intronic
1192429775 X:71103907-71103929 TTCTCCCAATATCTGCACTAAGG - Intronic
1194661702 X:96634995-96635017 ATTCCCCACCATATGGAGTAGGG + Intergenic
1195850660 X:109278511-109278533 TTATACCAACCTCTGGAGTAGGG - Intergenic