ID: 1096738761

View in Genome Browser
Species Human (GRCh38)
Location 12:53676714-53676736
Sequence TGGGACAGTCTAGGAATAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096738756_1096738761 -7 Left 1096738756 12:53676698-53676720 CCTCTTTCCTGGCTCCTGGGACA 0: 1
1: 0
2: 6
3: 36
4: 402
Right 1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG 0: 1
1: 1
2: 0
3: 7
4: 103
1096738752_1096738761 0 Left 1096738752 12:53676691-53676713 CCGAATCCCTCTTTCCTGGCTCC 0: 1
1: 1
2: 5
3: 46
4: 490
Right 1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG 0: 1
1: 1
2: 0
3: 7
4: 103
1096738755_1096738761 -6 Left 1096738755 12:53676697-53676719 CCCTCTTTCCTGGCTCCTGGGAC 0: 1
1: 1
2: 3
3: 62
4: 487
Right 1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG 0: 1
1: 1
2: 0
3: 7
4: 103
1096738750_1096738761 24 Left 1096738750 12:53676667-53676689 CCAGAAGATAGGGTTAAATATGA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG 0: 1
1: 1
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096738761 Original CRISPR TGGGACAGTCTAGGAATAAC GGG Intronic
901524100 1:9808586-9808608 TGGGATCGTCTAGTAATTACTGG - Intronic
903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG + Intronic
912869732 1:113293077-113293099 AGGGACAGTCAATAAATAACTGG - Intergenic
914701807 1:150140973-150140995 TGGGACAGCCTTTGAATAGCAGG + Intronic
915466602 1:156102092-156102114 TGGGACAGGCTGGGAATTCCTGG + Intronic
919354470 1:196503581-196503603 TCTGACAGTCTAGGATTACCAGG + Intronic
920567173 1:206983520-206983542 TGGGACAGTCTAAGAACTTCAGG - Intergenic
922184225 1:223259736-223259758 CGGGGCAGTCTAGGAAGAAGAGG - Intronic
922241791 1:223760193-223760215 GGGGTCAGGCTAGGAAGAACAGG + Intronic
1073753981 10:106561096-106561118 TGGGAGAGTCTAGCAAGAACAGG - Intergenic
1077255270 11:1578963-1578985 TGGGAATGTATAGGAATAATTGG - Intergenic
1078992294 11:16661817-16661839 TGGGAGACTCTAGGGATTACAGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1092090549 12:5800208-5800230 TGGCACATCCTAGGAAGAACAGG + Intronic
1092132900 12:6124855-6124877 TGGGGCACTCTAGGAAGACCAGG - Intergenic
1092803267 12:12193479-12193501 TGGGTCAGTCTAGCACTAAAGGG - Intronic
1094711434 12:32967042-32967064 TGGGACAGTATGGGAATGTCTGG - Intergenic
1096088990 12:48885730-48885752 AGGGCCAGTCTAGGAATGAGGGG + Intergenic
1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG + Intronic
1097954364 12:65468504-65468526 TGGGCCAGTCTAGGAGGAATTGG + Intronic
1099844084 12:88006624-88006646 TGCAGCAGGCTAGGAATAACAGG - Intronic
1100997797 12:100321497-100321519 TGGCAAATTCTGGGAATAACAGG - Intronic
1106628907 13:31449759-31449781 TGTTACAGTCTAGCAAAAACAGG + Intergenic
1109088639 13:58010095-58010117 TGTGTGTGTCTAGGAATAACTGG - Intergenic
1111509033 13:89236322-89236344 TGGGAAAGTCTTGAAATAAGAGG - Intergenic
1112382429 13:98905020-98905042 TGGGACAGGCTTGGAATGAAGGG + Intronic
1114049327 14:18908764-18908786 TGGGACAGGCTAGGAAAAGTGGG - Intergenic
1114113236 14:19493167-19493189 TGGGACAGGCTAGGAAAAGTGGG + Intergenic
1116713787 14:48402494-48402516 TGGGACAGCCAAGGAACAAAAGG + Intergenic
1118689538 14:68324841-68324863 TGGTACAGGTGAGGAATAACTGG - Intronic
1119162531 14:72464936-72464958 GGGGACAGTCTAGTAAATACAGG + Intronic
1119784132 14:77299900-77299922 TGGGACAGTAGAGGAAGCACTGG - Intronic
1127596697 15:60490226-60490248 TGGTATTGTCTAGGAATAAAAGG + Intronic
1133913680 16:10088705-10088727 TGGGATAGTCTAGGAAATGCTGG - Intronic
1138277004 16:55742517-55742539 TGTAAGAGTCTAGGAATCACGGG + Intergenic
1138861880 16:60768199-60768221 TGAGATAGTCAAGGAATAAGGGG + Intergenic
1140730680 16:77853146-77853168 TGTGACAGGCTAGGAAAACCCGG + Intronic
1141141957 16:81502270-81502292 TGGGACTGTCCAGGCAAAACAGG - Intronic
1152138691 17:78523487-78523509 AGGGACTGTATATGAATAACTGG + Intronic
1152731818 17:81976273-81976295 TGGGACAGTCTAAGGAAAATAGG + Intergenic
1155036294 18:22027459-22027481 TGGGTCTGTTTAGGAATAATTGG - Intergenic
1155372877 18:25121650-25121672 GGGGACAGTGAAGGAACAACAGG + Intronic
1155685837 18:28549066-28549088 TGGGAAAGTCTATGAATATGTGG + Intergenic
1155988004 18:32251233-32251255 TGGGACAGCCTTGGGAGAACAGG + Intronic
1159168405 18:64731121-64731143 TGGCACAGGCCAGGAAAAACTGG - Intergenic
926943156 2:18159434-18159456 TGGGGTAGTTTAGGAATCACAGG + Intronic
931432457 2:62219056-62219078 TGGGAGAGGCCATGAATAACTGG - Intronic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
937320388 2:120957236-120957258 TGGGAAAGGCAAGGAAGAACGGG - Intronic
937632731 2:124121705-124121727 TGGGATAGTTTAGGAATGATTGG - Intronic
941113582 2:161445751-161445773 TGGGACAGTGTTGGAATGAGAGG - Intronic
941196993 2:162465043-162465065 GGGGAAAGTCTAGGAATAAAAGG + Intronic
943815318 2:192247195-192247217 TCAGACAGTATAAGAATAACAGG + Intergenic
946737981 2:222773585-222773607 TGGCACAGACTTGGAAAAACTGG + Intergenic
946999097 2:225432727-225432749 TGTGATAGTCTAAGCATAACCGG + Intronic
1169797248 20:9476484-9476506 AGGCACAGTCTGGGAATGACAGG + Intronic
1179021637 21:37646344-37646366 TGTGAAATTCTAGTAATAACAGG + Intronic
1180676708 22:17591463-17591485 TGGGACAGGGAAGGAAGAACAGG + Intergenic
1184103555 22:42354303-42354325 TGGCACAGTCGGGGAGTAACAGG - Intergenic
1184483247 22:44760360-44760382 TGGGAAAGTCCAGGAATGATGGG - Intronic
1184649275 22:45912313-45912335 TGGGACAGTCCTGGACTTACTGG + Intergenic
950690876 3:14656415-14656437 TGGGACACTGCAGAAATAACTGG - Intronic
951918068 3:27822603-27822625 TGGGACAGTCCAGGAAAACGGGG + Intergenic
952075246 3:29688181-29688203 TGGTACTGGCTAAGAATAACAGG - Intronic
954376518 3:50196727-50196749 TGGGACAGTCTTGGATCAAGAGG + Intergenic
955569765 3:60291846-60291868 TGCCACAGCCTAGGAATATCAGG + Intronic
960420808 3:117443101-117443123 AGGAACAGTCTAGGATTTACGGG + Intergenic
961960761 3:130852523-130852545 TGGGACAACCTAGGAACAGCTGG + Intronic
962705353 3:138038193-138038215 TGGGACAGTCCTGGACAAACTGG - Intergenic
963493214 3:146027322-146027344 TTGGACAGAGTAGGAATAACTGG + Intergenic
963731593 3:148979611-148979633 TGCGACAGACTAGGAATAGAGGG - Intergenic
963928220 3:150974287-150974309 TGGGTTCGTCTAGGAGTAACAGG + Intergenic
964365767 3:155949522-155949544 TGTGACAGTCTAGTGTTAACTGG + Intergenic
966239329 3:177738843-177738865 AGGTACAGTCTACAAATAACTGG + Intergenic
972731027 4:41795427-41795449 TGAGACAGTCTCAGCATAACTGG + Intergenic
982246884 4:153362151-153362173 TAGAACAGTATAGGAAAAACAGG - Intronic
984200214 4:176710460-176710482 AGGGACAGTTTAGGAAAACCTGG - Intronic
984856140 4:184197861-184197883 TGGGCCAGACTGGGAGTAACTGG + Intronic
989017070 5:36949754-36949776 TGGGACAGATTTGGAATAAAAGG - Intronic
990278909 5:54229007-54229029 TGGGACACTCTAGGAACACAAGG + Intronic
993767261 5:91876310-91876332 TAGGACATTCTAGCATTAACTGG + Intergenic
995606895 5:113866582-113866604 TGGCACAGTTTTGGAATAGCTGG + Intergenic
995842520 5:116456716-116456738 TGGGTCAGCCCAGGCATAACTGG + Intronic
1000756883 5:165172455-165172477 TGGGAAATTCAAGAAATAACTGG + Intergenic
1003012927 6:2442977-2442999 TTGGACAGGGTAGAAATAACAGG + Intergenic
1003999939 6:11588331-11588353 TAGGAAAGTCTGAGAATAACAGG - Intergenic
1004596284 6:17102647-17102669 GGGCACAGGCAAGGAATAACCGG + Intronic
1005290780 6:24376561-24376583 TGGGACATCCTAGAAATAACTGG + Intergenic
1006458944 6:34146841-34146863 TGGGAGGGTCTGGGAATAACAGG + Intronic
1014142055 6:117955017-117955039 TGGAATAGTCTAGGAATACATGG - Intronic
1015449043 6:133342695-133342717 TGGGCCTGGCTAGGATTAACAGG + Intronic
1015669867 6:135676433-135676455 TCAGACAGTCAAGAAATAACAGG - Intergenic
1019912956 7:4112544-4112566 TGGGACAGAATTGGAATATCAGG - Intronic
1020802257 7:12746422-12746444 TAGGACAGTCTGGGAATAAAAGG - Intergenic
1022816560 7:33919872-33919894 TAGCACAGTCAAGGACTAACAGG - Intronic
1027267451 7:76502223-76502245 TGGGCCAGTCTTGGAAAAAGAGG - Intronic
1030559983 7:111072999-111073021 AGGAACATTCTAGGAATAACTGG + Intronic
1032117697 7:129130477-129130499 TGGGGCAGTCTGGGATAAACTGG - Intergenic
1034218966 7:149429941-149429963 AGGGCCTGTCTAGGAAAAACAGG - Intergenic
1034659479 7:152757147-152757169 TGGGACTGGCTAGTAATAAAGGG - Intergenic
1034830209 7:154302482-154302504 TGGGGAAGTTTAGGAATTACTGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036681997 8:10881854-10881876 GGGGACAGTTTGGGAATAAGAGG - Intergenic
1037676306 8:21053789-21053811 TGGGAAAGTCTAGGAAAACTGGG - Intergenic
1043187346 8:77170862-77170884 TGTGAAAGTCTTGGAACAACTGG + Intergenic
1045956233 8:107911093-107911115 TGGGGGAGCCTAGGAAGAACAGG - Intronic
1047983373 8:130206815-130206837 TGGGTCAGGAAAGGAATAACTGG - Intronic
1049963702 9:759961-759983 TATGACAATCTAGGAACAACAGG + Intergenic
1057208400 9:93186417-93186439 TGGGACAGCCTAGGAAGCAGAGG + Intronic
1193808642 X:86024366-86024388 TGGGTCAGTGTAGATATAACTGG - Intronic
1194779581 X:98008586-98008608 GGGGACAGTCAAGGATTAATTGG - Intergenic