ID: 1096741484

View in Genome Browser
Species Human (GRCh38)
Location 12:53696941-53696963
Sequence CTGGATCTTGAAATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096741484_1096741490 4 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741490 12:53696968-53696990 CTCGCAAAACAATCCAGTTTAGG No data
1096741484_1096741495 18 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741495 12:53696982-53697004 CAGTTTAGGAGGGAGTTAGAGGG No data
1096741484_1096741491 7 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741491 12:53696971-53696993 GCAAAACAATCCAGTTTAGGAGG No data
1096741484_1096741494 17 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741494 12:53696981-53697003 CCAGTTTAGGAGGGAGTTAGAGG No data
1096741484_1096741498 25 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741498 12:53696989-53697011 GGAGGGAGTTAGAGGGGGAGAGG No data
1096741484_1096741496 19 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741496 12:53696983-53697005 AGTTTAGGAGGGAGTTAGAGGGG No data
1096741484_1096741497 20 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741497 12:53696984-53697006 GTTTAGGAGGGAGTTAGAGGGGG No data
1096741484_1096741492 8 Left 1096741484 12:53696941-53696963 CCCTCCTCCATTTCAAGATCCAG No data
Right 1096741492 12:53696972-53696994 CAAAACAATCCAGTTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096741484 Original CRISPR CTGGATCTTGAAATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr