ID: 1096743573

View in Genome Browser
Species Human (GRCh38)
Location 12:53711613-53711635
Sequence CTGTGTATCAGAAGCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096743573 Original CRISPR CTGTGTATCAGAAGCAACCA GGG Intronic
903181114 1:21605317-21605339 CTGTGTGTCCGCAGCAGCCAGGG - Intronic
903721422 1:25408455-25408477 CTGTGTATCACAAGGAATCCAGG - Intronic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
904953741 1:34265950-34265972 ATGTGTATCAGAGTCACCCAGGG + Intergenic
905848812 1:41257872-41257894 CAGAGTGTCTGAAGCAACCAGGG - Intergenic
907434868 1:54438976-54438998 CTCTGTCTCACAAGCACCCACGG + Intergenic
913298671 1:117346963-117346985 CTGTGTATCATAATCACCCATGG - Intergenic
914000367 1:143689582-143689604 TTGTGTTTCAGGAGAAACCATGG + Intergenic
915626313 1:157116012-157116034 CTTTGCATCAGCAGGAACCAGGG - Intergenic
916228589 1:162516246-162516268 CTGTTCATCAGAAGTAACAAAGG - Intronic
919759899 1:201091408-201091430 CGGTGTTTCAGAACCAGCCATGG + Intronic
919981631 1:202645562-202645584 CATTTTATCAGAAGGAACCATGG - Intronic
920036094 1:203066664-203066686 CTGTGGGTCAGAAGGAACCCTGG - Intronic
920122979 1:203672653-203672675 CTGGGTTCCAGAGGCAACCAGGG + Intronic
920682905 1:208086103-208086125 CTGTGTGTCAAAAGCAATCATGG - Intronic
922654648 1:227370961-227370983 CTCTGGCTCAGAAGCAGCCAAGG + Intergenic
924086170 1:240454162-240454184 CTGTGGATCCGTAGCAATCATGG + Intronic
1064422998 10:15206286-15206308 CTGTGTATGAGAATCAGCTAGGG + Intergenic
1068034071 10:51738091-51738113 CTGTGTATCAGAATAATCCTGGG - Intronic
1068392305 10:56414172-56414194 CTGTGTTTCTTAAGAAACCAGGG + Intergenic
1070229868 10:74554095-74554117 CAGAGTATAAGAAGCTACCATGG - Intronic
1071057582 10:81529258-81529280 ATGTCTATCCAAAGCAACCATGG + Intergenic
1072424168 10:95315338-95315360 CTGTTTTTCAGAAGGAACCCAGG + Intronic
1073583074 10:104685315-104685337 CTGGGTGTTAGAAGCAACCCAGG - Intronic
1073682611 10:105720370-105720392 GTGTGTGTCAGCATCAACCATGG - Intergenic
1077522778 11:3046123-3046145 CTGTGTAACAGAATGGACCATGG - Intronic
1078491442 11:11772875-11772897 TTGTCTCTCAGAAGCAGCCAGGG + Intergenic
1080802848 11:35624167-35624189 CAGTGTATCAGAAGTAGCCCAGG - Intergenic
1081623058 11:44630526-44630548 CCGTGTATCTGAATCAACCGAGG - Intergenic
1081918154 11:46747752-46747774 GTGTGTTCCAGAAACAACCAGGG + Intronic
1086375554 11:86196411-86196433 CTGAGTAGCAGCAGCACCCAAGG - Intergenic
1088439434 11:109852730-109852752 CTGTGTTTCAGAATCACCCATGG - Intergenic
1088785927 11:113181761-113181783 CTGGACCTCAGAAGCAACCAGGG + Intronic
1090962814 11:131572314-131572336 CTCTGTATCAGAAGGATCCTGGG - Intronic
1093111586 12:15159223-15159245 CTTTGTCTCAGAAGTCACCAGGG + Intronic
1093121317 12:15274753-15274775 CTTTATTTCAGAAGTAACCAAGG + Intronic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1103074096 12:117968531-117968553 CTGTTTCTCAGAAGCAAACCAGG + Intronic
1103501902 12:121409551-121409573 CTGTATATCAGAATTACCCAGGG + Intronic
1105564565 13:21531469-21531491 CTGAGTAGCAGCAGCACCCAAGG - Intronic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1108972022 13:56388465-56388487 ATGTGTATCAGAAGGTAGCATGG - Intergenic
1110103157 13:71634758-71634780 CTGTGCATCAGAGTCACCCATGG + Intronic
1114679806 14:24474952-24474974 CTATGTAACAGAGGCCACCAAGG - Intergenic
1115119633 14:29925536-29925558 AGGTGTCTCAGAAGCTACCAAGG - Intronic
1115182242 14:30642498-30642520 CTGAGTATAAGAATCACCCAGGG - Intronic
1115627212 14:35205740-35205762 CTGTGTGTATGAAGCCACCATGG - Intronic
1116142027 14:41009076-41009098 CTACATATCAGAAGCAACTAAGG - Intergenic
1116656836 14:47664763-47664785 CTGTTTAGCAGCAGCAACTATGG - Intronic
1117685174 14:58245357-58245379 CTGTGAATCAGCAGCACCCTAGG - Intronic
1117999789 14:61512166-61512188 CTGGGGATCAGAAGCACTCAGGG + Intronic
1118325420 14:64777296-64777318 CTGAGTTTCAGAAGCAGGCAGGG + Intronic
1119882793 14:78114189-78114211 CTGTGTATCTGAACACACCAAGG - Intergenic
1121705809 14:95992823-95992845 CAGTGCATCAGAATCACCCAAGG + Intergenic
1121937867 14:98037120-98037142 CTTTATATCATAAGTAACCAAGG - Intergenic
1122203117 14:100134498-100134520 CTGGGTATGAGAAGGGACCATGG - Intronic
1122594738 14:102881964-102881986 CTGTGCATCCTAAGCAACCAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123191498 14:106576331-106576353 CTGTGCAGCAGAGGCAGCCATGG - Intergenic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1124497319 15:30194298-30194320 CATTTTATCAGAAGGAACCATGG - Intergenic
1124746255 15:32344349-32344371 CATTTTATCAGAAGGAACCATGG + Intergenic
1125633306 15:41166370-41166392 CTCTGTATAATAACCAACCATGG + Intergenic
1125664664 15:41420757-41420779 CTCTGTGTCAGAAGCCACCTGGG + Intronic
1125892682 15:43277966-43277988 CCGTGTACCTGAAGCAAACATGG - Intronic
1126648717 15:50900430-50900452 CTGTGGATCAAAATCCACCATGG - Intergenic
1128219447 15:65957861-65957883 CTGTTTATCAGAAGATGCCAAGG + Intronic
1128290167 15:66472383-66472405 CTGTCTACCAGATGGAACCATGG + Intronic
1129292172 15:74576827-74576849 TAGTGTATCAGACCCAACCATGG + Intronic
1129945240 15:79533969-79533991 CTGTGCATTAGCAGCATCCATGG - Intergenic
1129999620 15:80035433-80035455 CTGTCTATCAGAACCACCTAGGG + Intergenic
1130199691 15:81813451-81813473 CTGTGGAAGAGAACCAACCAGGG + Intergenic
1130927793 15:88398200-88398222 CTGTGCATCAGAAGCAGCTAGGG + Intergenic
1135648675 16:24186567-24186589 CTGTGTGTCTGAATAAACCAGGG + Intronic
1137722335 16:50634760-50634782 CTGGGTTCCAGAAGCATCCAGGG - Exonic
1137863772 16:51872549-51872571 TTGTGTTTCAGAAGCTACAAGGG - Intergenic
1138858178 16:60721139-60721161 CTGTGTATCATATGAACCCAGGG - Intergenic
1141759055 16:86015305-86015327 CTGTAGGTCAGAATCAACCATGG + Intergenic
1142167747 16:88601874-88601896 GTGTCTATCAGAAACAGCCAGGG - Intronic
1142374210 16:89698394-89698416 CTGAGCATCAGAAGCTGCCAAGG - Intronic
1144014096 17:11177321-11177343 CTGCTTACCAGAAGCAGCCATGG - Intergenic
1145957629 17:28865513-28865535 CTGTTTATCAGGAGCCAACACGG + Intergenic
1146498120 17:33341144-33341166 GTGTGCATCAGAATCAACCGAGG + Intronic
1147029961 17:37625291-37625313 CTGTTTATAAGAAGAAAGCAAGG - Intronic
1147646751 17:42038878-42038900 CTGTGTGTCAGAAACAAGCACGG + Intronic
1148843642 17:50515569-50515591 CTGTGCATCAGAATCACCTAGGG + Intronic
1149602312 17:57901053-57901075 CTGTGTATCAGAATGACCCAGGG - Intronic
1150514302 17:65791401-65791423 CTGATTATCAGAAGCAACCAGGG - Intronic
1151204882 17:72499210-72499232 CTGTGCATCAGAATCACCCGTGG - Intergenic
1152180554 17:78818336-78818358 CTGTGTATAACAAGCATTCAGGG + Intronic
1154338779 18:13486476-13486498 ATATGTAGCAGAAGCCACCAGGG + Intronic
1155831021 18:30514722-30514744 CTGTATATTAGAAACACCCAGGG + Intergenic
1157646913 18:49283547-49283569 CTGAGAAACTGAAGCAACCAAGG + Intronic
1158318021 18:56233789-56233811 CTGCGTAGGAGAAGCACCCAGGG + Intergenic
1160428460 18:78794323-78794345 CTCTGTATCAGATGCATCCCAGG - Intergenic
1162553173 19:11369727-11369749 CTGTGTGTCAGGAGAGACCACGG - Intergenic
1163597840 19:18230862-18230884 CTGTGTTGGAGACGCAACCATGG - Intronic
1164720264 19:30426707-30426729 CTGTGTATAGGAACCAACCCTGG - Intronic
1166575691 19:43835399-43835421 GTGTGTAGCAGAAGCAGGCATGG + Intronic
1167054702 19:47102515-47102537 CTGTGCAGCACAGGCAACCATGG + Intronic
1168190035 19:54731378-54731400 CAGTGTACCAGATGCAACCCTGG + Intronic
925742763 2:7020169-7020191 CTGAGTGTCAGAGGCAAGCAGGG + Intronic
925976828 2:9147748-9147770 CTGAAAATCAGAAGCCACCATGG - Intergenic
926067673 2:9857242-9857264 CTGTGTATAGGAAGCATCTACGG - Intronic
927107744 2:19842352-19842374 CAGTGAATCAGAATCAATCATGG - Intergenic
927423322 2:22955177-22955199 CCATGTAAAAGAAGCAACCATGG - Intergenic
928137832 2:28701837-28701859 CAATGTATAAGAAACAACCAGGG + Intergenic
928693458 2:33824505-33824527 CTTTGTGCCAGAAGTAACCAGGG - Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930850895 2:55959142-55959164 CTGGGTATGACAAGCAAGCATGG + Intergenic
938969884 2:136422334-136422356 CTGTGTATCAGAATCACCCTGGG + Intergenic
938970438 2:136426287-136426309 CTGTGCATCAAAACCAGCCAGGG - Intergenic
939810985 2:146831555-146831577 CTGTGAACCAGAAGGAAGCAGGG - Intergenic
940018727 2:149134246-149134268 TTGTAAATCAGAAGCAGCCAAGG - Intronic
940282171 2:151999594-151999616 CTGTGCGTCAGAATCACCCAAGG - Intronic
941790603 2:169548274-169548296 CTGTGTATCGGAAACAAAAAAGG - Intronic
942399554 2:175587113-175587135 CTGAGCATCAGAATCAACCTGGG + Intergenic
943866703 2:192933511-192933533 ATGGTTATCAGAAGCAAGCAAGG - Intergenic
945941274 2:215953318-215953340 CTGTATATTAGAATCACCCAGGG + Intronic
945943390 2:215971857-215971879 CTGTGTTTCAACATCAACCAAGG + Intronic
947458719 2:230283199-230283221 CTGTCTTTCAGAAGAACCCAAGG - Intronic
948404826 2:237709460-237709482 CTGTGTATTAAAATCAACCCTGG - Intronic
1169741462 20:8899420-8899442 CTGTGTCATAGATGCAACCACGG - Intronic
1169821154 20:9711640-9711662 CTGTGGTACAGAAGCAGCCAAGG - Intronic
1170476313 20:16718395-16718417 CTGTATATCAGAGGCATCCATGG + Intergenic
1171158904 20:22903867-22903889 TTGTGTATCAGAAGCAGCAGTGG + Intergenic
1171242990 20:23586505-23586527 CTGTGGGTGAGAAGCAATCAGGG - Intergenic
1171336811 20:24392764-24392786 CTGGGTGTCAGAAGCAGACAAGG - Intergenic
1171380965 20:24733981-24734003 CTGTTTGTCAAAACCAACCAAGG + Intergenic
1171425902 20:25048513-25048535 CTGCACATCAGAACCAACCATGG - Intronic
1171503186 20:25610614-25610636 CTCTGTATCATAAATAACCAAGG + Intergenic
1172979359 20:38929259-38929281 CTGTGTATCAGACACTACCATGG + Intronic
1179073123 21:38091671-38091693 CTGTCTATCAGGAACAGCCAGGG + Intronic
1179998812 21:44985987-44986009 CTGTGTTTCTGCAGCAAACAGGG - Intergenic
1180149999 21:45942553-45942575 CTGTGTGTGAGAAGAAACCCAGG - Intergenic
1182185496 22:28397561-28397583 ATGTCTATCAGAAGCATCCGTGG - Intronic
1183044863 22:35211447-35211469 CTATGTATCAGGACCATCCAAGG - Intergenic
1184794957 22:46726805-46726827 CTGTGTATCAGACCCATCAAGGG - Intronic
949185230 3:1183251-1183273 CTGTGAATCCGAAGCTATCATGG + Intronic
950538918 3:13598451-13598473 CTATGTAGCAGATGCTACCAGGG - Intronic
951438336 3:22691398-22691420 CTGAGTACCAGAAGCAGCAATGG + Intergenic
954347660 3:50013748-50013770 CTGAGAAGCAGCAGCAACCATGG + Intronic
957378497 3:79392147-79392169 ATGTGTCAGAGAAGCAACCACGG + Intronic
957580485 3:82066133-82066155 CTGTGTATCAGAAAATTCCAAGG - Intergenic
957615416 3:82519952-82519974 CTCTGTATCAGAAACAAAGAAGG + Intergenic
959332600 3:105024555-105024577 CTGTGCATCAGGAGCAAGTATGG + Intergenic
959663263 3:108892876-108892898 CTGTGTTTCAGAAGGAAGAAGGG - Intergenic
959833728 3:110893972-110893994 ATGTGTATCAGAATTATCCAGGG + Intergenic
962024820 3:131536854-131536876 CTTTGTATGAGAAACAGCCAGGG - Intronic
963078017 3:141366301-141366323 CTGTGTATATGAAGCAAGCAAGG + Intronic
963250644 3:143100046-143100068 CTTTGAATCAGGAGGAACCATGG + Intergenic
964039296 3:152239800-152239822 CTGTCTACCAAAAGCAACGAAGG + Intergenic
968226479 3:196975560-196975582 CTGTACATCAGAAGCCACCGTGG - Intergenic
969073655 4:4559688-4559710 CTCTGTATCACAAGCTACTAAGG - Intergenic
969404965 4:6985238-6985260 CTGGGTATCAGATGCTACTATGG - Intronic
970301507 4:14686026-14686048 CTGTGTATGAGAAGTGACTATGG - Intergenic
970938186 4:21599628-21599650 CTTTGTAGTAGAAGCAACAAAGG - Intronic
971648408 4:29238283-29238305 CTGTGTATCAGAAAAAAAAAAGG + Intergenic
974833689 4:67220621-67220643 CTGTGTAGAAGAAGAAACAATGG - Intergenic
976563870 4:86531722-86531744 CTTTGTGTCAGGAGAAACCATGG - Intronic
982418386 4:155164043-155164065 CTGTGTAGAAGAAGAAACCTTGG - Intergenic
983960450 4:173746738-173746760 CCCTGTCTCAGAAGCAACAAGGG - Intergenic
984414085 4:179434852-179434874 CTTTGTATCAGAACAAGCCAGGG - Intergenic
987017403 5:13834860-13834882 CTTTGCATGAGAAGGAACCATGG + Intronic
987116475 5:14730296-14730318 CTGTGAATGTGAAGAAACCATGG - Intronic
990017970 5:51089549-51089571 TTGTGTAACAGAAATAACCATGG - Intergenic
991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG + Intronic
992158875 5:73981359-73981381 ATGATTATCAGAATCAACCAGGG - Intergenic
992607420 5:78473244-78473266 CACTGTATCAGAAGCACTCAGGG + Intronic
992634707 5:78716446-78716468 ATGTGTCCCAGTAGCAACCAAGG + Intronic
995016274 5:107313241-107313263 CTGAATAACAGAAGGAACCAGGG + Intergenic
995137237 5:108692935-108692957 CTGAGAATCAGAAGCACCGAGGG + Intergenic
995183862 5:109252210-109252232 CTGTGTATCACCAGCAACCTGGG - Intergenic
997783064 5:136679257-136679279 CTGTGAGTGAGAAGAAACCATGG - Intergenic
998237272 5:140408979-140409001 CTGTGCATTAGAAGCATCCCTGG + Intronic
999363256 5:151004026-151004048 CTGAGAATCAGAAGAAACCCAGG + Intergenic
1001648306 5:173298083-173298105 CTGTGTAGCAGACGCTGCCATGG - Intergenic
1003970314 6:11292902-11292924 CTGGGTATCAGAAACATCCATGG + Intronic
1004948501 6:20642156-20642178 ATGTGTATTAGAAGAAAACATGG + Intronic
1005525564 6:26644353-26644375 CTGAGGATCAGAAGCAAAAATGG + Intronic
1006983158 6:38161817-38161839 CTGTGCACCAGCAGCACCCATGG + Intergenic
1007487679 6:42193538-42193560 CTCTGAATCAGCAGCAACCCTGG - Intronic
1008645309 6:53508152-53508174 GTGTGCATCAGAACCACCCATGG - Intronic
1009806203 6:68604726-68604748 CTGTGCGTCAGATCCAACCATGG + Intergenic
1010794953 6:80107389-80107411 CTGTATGTAAGAAGAAACCAAGG - Intronic
1011042552 6:83047110-83047132 GTGTGCAACAGACGCAACCAGGG - Intronic
1011495736 6:87935380-87935402 CTGCATATCAGAATCACCCAGGG + Intergenic
1012430957 6:99163165-99163187 CTCTGCATCAGAGGAAACCATGG + Intergenic
1013631084 6:111986680-111986702 CTGTGTCTCAGGATCACCCAGGG - Intergenic
1014759838 6:125344424-125344446 CTGAGTATCAAAAGAAGCCAAGG + Intergenic
1016414821 6:143821134-143821156 CTGTGTATCAAATGCAGGCATGG + Intronic
1017216811 6:151917754-151917776 CTGTTTAGCCGAAGCAACCAAGG - Intronic
1017344298 6:153362015-153362037 CAGTGTATCAGATGCTTCCAAGG + Intergenic
1018054744 6:160042017-160042039 CTGTGTATAAGAGACAACCTAGG + Intronic
1019280342 7:196635-196657 GTGTGTCTCAGAAGCAACCTTGG + Intronic
1020657675 7:10946627-10946649 CAGTATATCAGTAGCACCCAAGG + Intergenic
1023165495 7:37339299-37339321 CTGTGTACAAGAAGCATCCAGGG - Intronic
1023332638 7:39134736-39134758 CTATATATCAGAATCACCCAAGG + Intronic
1026528638 7:71177404-71177426 CTGAGTATCAGGACCACCCAGGG - Intronic
1030788097 7:113687090-113687112 CTGTGAACCAGAAGGAACCTCGG + Intergenic
1031927919 7:127655903-127655925 GTGCTTATCAGAAGCAGCCATGG + Intronic
1032533486 7:132641115-132641137 TTGTGTATCACAGGCAAGCATGG - Intronic
1034204135 7:149301041-149301063 CTGAGAAACACAAGCAACCAAGG - Intergenic
1036604010 8:10290524-10290546 CTTTGCATCAGAAGCACCCATGG + Intronic
1037066968 8:14593846-14593868 GTGTGTATCAGAATCACCTAGGG + Intronic
1037321120 8:17644192-17644214 CCATTTATCAGAAGCAAACATGG + Exonic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1040058680 8:43085425-43085447 CTGAGTAGCAGCAGCACCCAAGG - Exonic
1041668476 8:60468728-60468750 CTTGGTATCAGAAGCAAGGATGG - Intergenic
1041728195 8:61037966-61037988 CTGAGGATGAGAAGAAACCAGGG + Intergenic
1043374619 8:79634755-79634777 CTGTGGATCTAAAGCATCCAGGG + Intronic
1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG + Intergenic
1049200025 8:141335492-141335514 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1049200101 8:141335886-141335908 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1049526490 8:143129419-143129441 ATTTGTAACAGAAGCAACCTTGG + Intergenic
1049529110 8:143145161-143145183 CTCTGTTTCAGAAGCTCCCAGGG - Intergenic
1049751430 8:144286129-144286151 CTGTTCATCAGAAGCCACCCAGG - Intronic
1050920890 9:11199257-11199279 GTGTGTATCAAAATCAATCAAGG - Intergenic
1056985998 9:91364210-91364232 CTGTGCTGCAGAGGCAACCAGGG - Intergenic
1057626801 9:96685230-96685252 CTGTGTATCAGAAGTTACATGGG - Intergenic
1057850907 9:98566042-98566064 CTGTGCCTCAGAATCACCCAGGG + Intronic
1059182554 9:112231601-112231623 CCCTGGATCAGAAGCTACCATGG + Intronic
1060189375 9:121582363-121582385 CTGAGTCTCAGAGGGAACCAGGG + Intronic
1061511142 9:131061524-131061546 CTGTGTAACAGAATCACCCAGGG - Intronic
1061533635 9:131233974-131233996 TTGTGTATCAGGACCATCCAAGG + Exonic
1062577269 9:137214547-137214569 CTGTGTGGAAGAAGCCACCAGGG - Intronic
1186273950 X:7919907-7919929 CAGTGTAACAGATGCAACCTTGG + Intronic
1186898520 X:14029693-14029715 CTGCGCATCAGAAGAAGCCAGGG + Intronic
1187964126 X:24594001-24594023 ATGAGTATCAGAATCACCCAAGG + Intronic
1188658371 X:32728493-32728515 CTGCGTATAAAAAGCAGCCATGG - Intronic
1193291473 X:79777826-79777848 CTGTGTATGAGAGTCAACAAAGG + Intergenic
1193737387 X:85175112-85175134 CAGTGCATCAGCATCAACCATGG + Intergenic
1194670478 X:96726427-96726449 ATGTGTTGCAGAAGGAACCATGG + Intronic
1195698304 X:107683038-107683060 CTGGGTATCAGGACCACCCAGGG - Intergenic
1197743205 X:129911751-129911773 CTGTGGATCTGAAGCAGGCAAGG - Exonic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1199623186 X:149716773-149716795 CTGAGCATGAGATGCAACCAGGG + Exonic
1200286600 X:154828721-154828743 CTGTGTCTAGGAAGCAACCTTGG - Intronic
1201021257 Y:9659640-9659662 GTGGGTATCAGAATCAAGCAGGG - Intergenic
1201193994 Y:11473926-11473948 ATTGGTATCAGAAGAAACCAGGG - Intergenic
1201669690 Y:16505121-16505143 CATTGTACCAAAAGCAACCATGG - Intergenic