ID: 1096749697

View in Genome Browser
Species Human (GRCh38)
Location 12:53751198-53751220
Sequence GGGGCGGCGGGAGGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749697_1096749708 -1 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data
1096749697_1096749718 28 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749718 12:53751249-53751271 GCACCTCCCAACGCCTGCAGGGG No data
1096749697_1096749717 27 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749717 12:53751248-53751270 CGCACCTCCCAACGCCTGCAGGG No data
1096749697_1096749704 -6 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749704 12:53751215-53751237 CGCCCCTCCTCTGAGCCCTGCGG No data
1096749697_1096749716 26 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749716 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749697 Original CRISPR GGGGCGGCGGGAGGGAGGCC AGG (reversed) Intergenic