ID: 1096749699

View in Genome Browser
Species Human (GRCh38)
Location 12:53751206-53751228
Sequence TCAGAGGAGGGGCGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749699_1096749716 18 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749716 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
1096749699_1096749708 -9 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data
1096749699_1096749720 24 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749699_1096749723 26 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749723 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
1096749699_1096749717 19 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749717 12:53751248-53751270 CGCACCTCCCAACGCCTGCAGGG No data
1096749699_1096749721 25 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749721 12:53751254-53751276 TCCCAACGCCTGCAGGGGTTGGG No data
1096749699_1096749718 20 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749718 12:53751249-53751271 GCACCTCCCAACGCCTGCAGGGG No data
1096749699_1096749725 27 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749725 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749699 Original CRISPR TCAGAGGAGGGGCGGCGGGA GGG (reversed) Intergenic