ID: 1096749702

View in Genome Browser
Species Human (GRCh38)
Location 12:53751211-53751233
Sequence AGGGCTCAGAGGAGGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749702_1096749720 19 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749702_1096749723 21 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749723 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
1096749702_1096749718 15 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749718 12:53751249-53751271 GCACCTCCCAACGCCTGCAGGGG No data
1096749702_1096749727 28 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749727 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
1096749702_1096749717 14 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749717 12:53751248-53751270 CGCACCTCCCAACGCCTGCAGGG No data
1096749702_1096749725 22 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749725 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
1096749702_1096749728 29 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749728 12:53751263-53751285 CTGCAGGGGTTGGGGGCGCTGGG No data
1096749702_1096749716 13 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749716 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
1096749702_1096749729 30 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749702_1096749721 20 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749721 12:53751254-53751276 TCCCAACGCCTGCAGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749702 Original CRISPR AGGGCTCAGAGGAGGGGCGG CGG (reversed) Intergenic