ID: 1096749704

View in Genome Browser
Species Human (GRCh38)
Location 12:53751215-53751237
Sequence CGCCCCTCCTCTGAGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749694_1096749704 29 Left 1096749694 12:53751163-53751185 CCTCCGCACGCACAGGACACACA No data
Right 1096749704 12:53751215-53751237 CGCCCCTCCTCTGAGCCCTGCGG No data
1096749695_1096749704 26 Left 1096749695 12:53751166-53751188 CCGCACGCACAGGACACACACAC No data
Right 1096749704 12:53751215-53751237 CGCCCCTCCTCTGAGCCCTGCGG No data
1096749697_1096749704 -6 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749704 12:53751215-53751237 CGCCCCTCCTCTGAGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749704 Original CRISPR CGCCCCTCCTCTGAGCCCTG CGG Intergenic