ID: 1096749708

View in Genome Browser
Species Human (GRCh38)
Location 12:53751220-53751242
Sequence CTCCTCTGAGCCCTGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749699_1096749708 -9 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data
1096749700_1096749708 -10 Left 1096749700 12:53751207-53751229 CCTCCCGCCGCCCCTCCTCTGAG No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data
1096749698_1096749708 -6 Left 1096749698 12:53751203-53751225 CCTCCCTCCCGCCGCCCCTCCTC No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data
1096749697_1096749708 -1 Left 1096749697 12:53751198-53751220 CCTGGCCTCCCTCCCGCCGCCCC No data
Right 1096749708 12:53751220-53751242 CTCCTCTGAGCCCTGCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749708 Original CRISPR CTCCTCTGAGCCCTGCGGCC CGG Intergenic