ID: 1096749710

View in Genome Browser
Species Human (GRCh38)
Location 12:53751230-53751252
Sequence GTGCGGAAGGCCGGGCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749710_1096749717 -5 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749717 12:53751248-53751270 CGCACCTCCCAACGCCTGCAGGG No data
1096749710_1096749720 0 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749710_1096749731 17 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749710_1096749733 29 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749710_1096749730 16 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749710_1096749727 9 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749727 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
1096749710_1096749721 1 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749721 12:53751254-53751276 TCCCAACGCCTGCAGGGGTTGGG No data
1096749710_1096749725 3 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749725 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
1096749710_1096749732 18 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749732 12:53751271-53751293 GTTGGGGGCGCTGGGGCTCGGGG No data
1096749710_1096749729 11 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749710_1096749716 -6 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749716 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
1096749710_1096749718 -4 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749718 12:53751249-53751271 GCACCTCCCAACGCCTGCAGGGG No data
1096749710_1096749728 10 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749728 12:53751263-53751285 CTGCAGGGGTTGGGGGCGCTGGG No data
1096749710_1096749723 2 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749723 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749710 Original CRISPR GTGCGGAAGGCCGGGCCGCA GGG (reversed) Intergenic