ID: 1096749713

View in Genome Browser
Species Human (GRCh38)
Location 12:53751239-53751261
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749713_1096749733 20 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749713_1096749729 2 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749713_1096749731 8 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749713_1096749728 1 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749728 12:53751263-53751285 CTGCAGGGGTTGGGGGCGCTGGG No data
1096749713_1096749732 9 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749732 12:53751271-53751293 GTTGGGGGCGCTGGGGCTCGGGG No data
1096749713_1096749725 -6 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749725 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
1096749713_1096749723 -7 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749723 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
1096749713_1096749720 -9 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749713_1096749721 -8 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749721 12:53751254-53751276 TCCCAACGCCTGCAGGGGTTGGG No data
1096749713_1096749727 0 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749727 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
1096749713_1096749734 27 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749734 12:53751289-53751311 CGGGGCGCTCACTCGGACCTCGG No data
1096749713_1096749730 7 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749713 Original CRISPR CGTTGGGAGGTGCGGAAGGC CGG (reversed) Intergenic