ID: 1096749715

View in Genome Browser
Species Human (GRCh38)
Location 12:53751247-53751269
Sequence CCTGCAGGCGTTGGGAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749715_1096749732 1 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749732 12:53751271-53751293 GTTGGGGGCGCTGGGGCTCGGGG No data
1096749715_1096749734 19 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749734 12:53751289-53751311 CGGGGCGCTCACTCGGACCTCGG No data
1096749715_1096749731 0 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749715_1096749729 -6 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749715_1096749730 -1 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749715_1096749733 12 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749715_1096749727 -8 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749727 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
1096749715_1096749728 -7 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749728 12:53751263-53751285 CTGCAGGGGTTGGGGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749715 Original CRISPR CCTGCAGGCGTTGGGAGGTG CGG (reversed) Intergenic