ID: 1096749719

View in Genome Browser
Species Human (GRCh38)
Location 12:53751252-53751274
Sequence CAACCCCTGCAGGCGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749719_1096749734 14 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749734 12:53751289-53751311 CGGGGCGCTCACTCGGACCTCGG No data
1096749719_1096749733 7 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749719_1096749731 -5 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749719_1096749730 -6 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749719_1096749732 -4 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749732 12:53751271-53751293 GTTGGGGGCGCTGGGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749719 Original CRISPR CAACCCCTGCAGGCGTTGGG AGG (reversed) Intergenic