ID: 1096749720

View in Genome Browser
Species Human (GRCh38)
Location 12:53751253-53751275
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749713_1096749720 -9 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749705_1096749720 13 Left 1096749705 12:53751217-53751239 CCCCTCCTCTGAGCCCTGCGGCC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749698_1096749720 27 Left 1096749698 12:53751203-53751225 CCTCCCTCCCGCCGCCCCTCCTC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749709_1096749720 8 Left 1096749709 12:53751222-53751244 CCTCTGAGCCCTGCGGCCCGGCC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749710_1096749720 0 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749707_1096749720 11 Left 1096749707 12:53751219-53751241 CCTCCTCTGAGCCCTGCGGCCCG No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749701_1096749720 20 Left 1096749701 12:53751210-53751232 CCCGCCGCCCCTCCTCTGAGCCC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749699_1096749720 24 Left 1096749699 12:53751206-53751228 CCCTCCCGCCGCCCCTCCTCTGA No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749700_1096749720 23 Left 1096749700 12:53751207-53751229 CCTCCCGCCGCCCCTCCTCTGAG No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749703_1096749720 16 Left 1096749703 12:53751214-53751236 CCGCCCCTCCTCTGAGCCCTGCG No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749706_1096749720 12 Left 1096749706 12:53751218-53751240 CCCTCCTCTGAGCCCTGCGGCCC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749702_1096749720 19 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749711_1096749720 -1 Left 1096749711 12:53751231-53751253 CCTGCGGCCCGGCCTTCCGCACC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data
1096749712_1096749720 -8 Left 1096749712 12:53751238-53751260 CCCGGCCTTCCGCACCTCCCAAC No data
Right 1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749720 Original CRISPR CTCCCAACGCCTGCAGGGGT TGG Intergenic
No off target data available for this crispr