ID: 1096749724

View in Genome Browser
Species Human (GRCh38)
Location 12:53751256-53751278
Sequence CCCCCAACCCCTGCAGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749724_1096749733 3 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749724_1096749731 -9 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749724_1096749734 10 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749734 12:53751289-53751311 CGGGGCGCTCACTCGGACCTCGG No data
1096749724_1096749732 -8 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749732 12:53751271-53751293 GTTGGGGGCGCTGGGGCTCGGGG No data
1096749724_1096749730 -10 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749724 Original CRISPR CCCCCAACCCCTGCAGGCGT TGG (reversed) Intergenic