ID: 1096749726

View in Genome Browser
Species Human (GRCh38)
Location 12:53751262-53751284
Sequence CCAGCGCCCCCAACCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749726_1096749734 4 Left 1096749726 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
Right 1096749734 12:53751289-53751311 CGGGGCGCTCACTCGGACCTCGG No data
1096749726_1096749736 28 Left 1096749726 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
Right 1096749736 12:53751313-53751335 GCCAATCGCCAGAGATCTAATGG No data
1096749726_1096749733 -3 Left 1096749726 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749726 Original CRISPR CCAGCGCCCCCAACCCCTGC AGG (reversed) Intergenic