ID: 1096749729

View in Genome Browser
Species Human (GRCh38)
Location 12:53751264-53751286
Sequence TGCAGGGGTTGGGGGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749707_1096749729 22 Left 1096749707 12:53751219-53751241 CCTCCTCTGAGCCCTGCGGCCCG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749711_1096749729 10 Left 1096749711 12:53751231-53751253 CCTGCGGCCCGGCCTTCCGCACC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749714_1096749729 -2 Left 1096749714 12:53751243-53751265 CCTTCCGCACCTCCCAACGCCTG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749712_1096749729 3 Left 1096749712 12:53751238-53751260 CCCGGCCTTCCGCACCTCCCAAC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749706_1096749729 23 Left 1096749706 12:53751218-53751240 CCCTCCTCTGAGCCCTGCGGCCC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749715_1096749729 -6 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749710_1096749729 11 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749703_1096749729 27 Left 1096749703 12:53751214-53751236 CCGCCCCTCCTCTGAGCCCTGCG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749702_1096749729 30 Left 1096749702 12:53751211-53751233 CCGCCGCCCCTCCTCTGAGCCCT No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749705_1096749729 24 Left 1096749705 12:53751217-53751239 CCCCTCCTCTGAGCCCTGCGGCC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749709_1096749729 19 Left 1096749709 12:53751222-53751244 CCTCTGAGCCCTGCGGCCCGGCC No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data
1096749713_1096749729 2 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749729 12:53751264-53751286 TGCAGGGGTTGGGGGCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749729 Original CRISPR TGCAGGGGTTGGGGGCGCTG GGG Intergenic