ID: 1096749730

View in Genome Browser
Species Human (GRCh38)
Location 12:53751269-53751291
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749709_1096749730 24 Left 1096749709 12:53751222-53751244 CCTCTGAGCCCTGCGGCCCGGCC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749707_1096749730 27 Left 1096749707 12:53751219-53751241 CCTCCTCTGAGCCCTGCGGCCCG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749715_1096749730 -1 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749724_1096749730 -10 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749713_1096749730 7 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749711_1096749730 15 Left 1096749711 12:53751231-53751253 CCTGCGGCCCGGCCTTCCGCACC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749706_1096749730 28 Left 1096749706 12:53751218-53751240 CCCTCCTCTGAGCCCTGCGGCCC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749705_1096749730 29 Left 1096749705 12:53751217-53751239 CCCCTCCTCTGAGCCCTGCGGCC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749719_1096749730 -6 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749714_1096749730 3 Left 1096749714 12:53751243-53751265 CCTTCCGCACCTCCCAACGCCTG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749710_1096749730 16 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749712_1096749730 8 Left 1096749712 12:53751238-53751260 CCCGGCCTTCCGCACCTCCCAAC No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data
1096749722_1096749730 -9 Left 1096749722 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
Right 1096749730 12:53751269-53751291 GGGTTGGGGGCGCTGGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749730 Original CRISPR GGGTTGGGGGCGCTGGGGCT CGG Intergenic
No off target data available for this crispr