ID: 1096749731

View in Genome Browser
Species Human (GRCh38)
Location 12:53751270-53751292
Sequence GGTTGGGGGCGCTGGGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749713_1096749731 8 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749722_1096749731 -8 Left 1096749722 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749715_1096749731 0 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749719_1096749731 -5 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749709_1096749731 25 Left 1096749709 12:53751222-53751244 CCTCTGAGCCCTGCGGCCCGGCC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749710_1096749731 17 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749714_1096749731 4 Left 1096749714 12:53751243-53751265 CCTTCCGCACCTCCCAACGCCTG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749724_1096749731 -9 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749712_1096749731 9 Left 1096749712 12:53751238-53751260 CCCGGCCTTCCGCACCTCCCAAC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749707_1096749731 28 Left 1096749707 12:53751219-53751241 CCTCCTCTGAGCCCTGCGGCCCG No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749705_1096749731 30 Left 1096749705 12:53751217-53751239 CCCCTCCTCTGAGCCCTGCGGCC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749706_1096749731 29 Left 1096749706 12:53751218-53751240 CCCTCCTCTGAGCCCTGCGGCCC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data
1096749711_1096749731 16 Left 1096749711 12:53751231-53751253 CCTGCGGCCCGGCCTTCCGCACC No data
Right 1096749731 12:53751270-53751292 GGTTGGGGGCGCTGGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749731 Original CRISPR GGTTGGGGGCGCTGGGGCTC GGG Intergenic