ID: 1096749733

View in Genome Browser
Species Human (GRCh38)
Location 12:53751282-53751304
Sequence TGGGGCTCGGGGCGCTCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096749713_1096749733 20 Left 1096749713 12:53751239-53751261 CCGGCCTTCCGCACCTCCCAACG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749719_1096749733 7 Left 1096749719 12:53751252-53751274 CCTCCCAACGCCTGCAGGGGTTG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749722_1096749733 4 Left 1096749722 12:53751255-53751277 CCCAACGCCTGCAGGGGTTGGGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749724_1096749733 3 Left 1096749724 12:53751256-53751278 CCAACGCCTGCAGGGGTTGGGGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749712_1096749733 21 Left 1096749712 12:53751238-53751260 CCCGGCCTTCCGCACCTCCCAAC No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749710_1096749733 29 Left 1096749710 12:53751230-53751252 CCCTGCGGCCCGGCCTTCCGCAC No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749711_1096749733 28 Left 1096749711 12:53751231-53751253 CCTGCGGCCCGGCCTTCCGCACC No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749715_1096749733 12 Left 1096749715 12:53751247-53751269 CCGCACCTCCCAACGCCTGCAGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749714_1096749733 16 Left 1096749714 12:53751243-53751265 CCTTCCGCACCTCCCAACGCCTG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data
1096749726_1096749733 -3 Left 1096749726 12:53751262-53751284 CCTGCAGGGGTTGGGGGCGCTGG No data
Right 1096749733 12:53751282-53751304 TGGGGCTCGGGGCGCTCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096749733 Original CRISPR TGGGGCTCGGGGCGCTCACT CGG Intergenic