ID: 1096750440

View in Genome Browser
Species Human (GRCh38)
Location 12:53755639-53755661
Sequence AAGTGTCCACAGGGGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096750433_1096750440 7 Left 1096750433 12:53755609-53755631 CCTGAACATTCTGAACTTTATTA No data
Right 1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG No data
1096750431_1096750440 29 Left 1096750431 12:53755587-53755609 CCTGGCTTTAATTACAGTAAGCC No data
Right 1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG No data
1096750432_1096750440 8 Left 1096750432 12:53755608-53755630 CCCTGAACATTCTGAACTTTATT No data
Right 1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096750440 Original CRISPR AAGTGTCCACAGGGGTGGGA TGG Intergenic
No off target data available for this crispr