ID: 1096751093

View in Genome Browser
Species Human (GRCh38)
Location 12:53759276-53759298
Sequence CCTGCTGGGTAGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096751093_1096751101 -7 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751101 12:53759292-53759314 CAGCAGGCAGTGAACAGCATAGG No data
1096751093_1096751103 1 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751103 12:53759300-53759322 AGTGAACAGCATAGGGAGAAAGG No data
1096751093_1096751102 -6 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751102 12:53759293-53759315 AGCAGGCAGTGAACAGCATAGGG No data
1096751093_1096751104 7 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG No data
1096751093_1096751105 8 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751105 12:53759307-53759329 AGCATAGGGAGAAAGGAGAAGGG No data
1096751093_1096751106 19 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751106 12:53759318-53759340 AAAGGAGAAGGGATTGCTCTTGG No data
1096751093_1096751107 20 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751107 12:53759319-53759341 AAGGAGAAGGGATTGCTCTTGGG No data
1096751093_1096751108 28 Left 1096751093 12:53759276-53759298 CCTCCCACCCTCTACCCAGCAGG No data
Right 1096751108 12:53759327-53759349 GGGATTGCTCTTGGGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096751093 Original CRISPR CCTGCTGGGTAGAGGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr