ID: 1096755163

View in Genome Browser
Species Human (GRCh38)
Location 12:53793379-53793401
Sequence CTTTTTAAGCAGATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096755158_1096755163 -8 Left 1096755158 12:53793364-53793386 CCTGTTATTTGTTCCCTTTTTAA No data
Right 1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG No data
1096755156_1096755163 6 Left 1096755156 12:53793350-53793372 CCTCAGTGGGTGGCCCTGTTATT No data
Right 1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG No data
1096755157_1096755163 -7 Left 1096755157 12:53793363-53793385 CCCTGTTATTTGTTCCCTTTTTA No data
Right 1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG No data
1096755151_1096755163 21 Left 1096755151 12:53793335-53793357 CCTTTGGAGTCTATCCCTCAGTG No data
Right 1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG No data
1096755155_1096755163 7 Left 1096755155 12:53793349-53793371 CCCTCAGTGGGTGGCCCTGTTAT No data
Right 1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096755163 Original CRISPR CTTTTTAAGCAGATGGAACA GGG Intergenic
No off target data available for this crispr