ID: 1096755408

View in Genome Browser
Species Human (GRCh38)
Location 12:53795434-53795456
Sequence CAGAGCAGGGAGAATTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096755408_1096755414 23 Left 1096755408 12:53795434-53795456 CCAAACCAATTCTCCCTGCTCTG No data
Right 1096755414 12:53795480-53795502 TAATATTTATTTGAGTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096755408 Original CRISPR CAGAGCAGGGAGAATTGGTT TGG (reversed) Intergenic
No off target data available for this crispr