ID: 1096760008

View in Genome Browser
Species Human (GRCh38)
Location 12:53833563-53833585
Sequence TGTTCTCTTTTCCTTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096760008_1096760015 13 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760015 12:53833599-53833621 GGAGGCCTGACCCTAGACCAGGG No data
1096760008_1096760012 -8 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760012 12:53833578-53833600 AGAGAACAAGGTTGGGAATCAGG No data
1096760008_1096760014 12 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760014 12:53833598-53833620 AGGAGGCCTGACCCTAGACCAGG No data
1096760008_1096760013 -5 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760013 12:53833581-53833603 GAACAAGGTTGGGAATCAGGAGG No data
1096760008_1096760018 18 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760018 12:53833604-53833626 CCTGACCCTAGACCAGGGGTTGG No data
1096760008_1096760016 14 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096760008 Original CRISPR TGTTCTCTTTTCCTTGCTTG AGG (reversed) Intergenic
No off target data available for this crispr