ID: 1096760016

View in Genome Browser
Species Human (GRCh38)
Location 12:53833600-53833622
Sequence GAGGCCTGACCCTAGACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096760008_1096760016 14 Left 1096760008 12:53833563-53833585 CCTCAAGCAAGGAAAAGAGAACA No data
Right 1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096760016 Original CRISPR GAGGCCTGACCCTAGACCAG GGG Intergenic
No off target data available for this crispr