ID: 1096769257

View in Genome Browser
Species Human (GRCh38)
Location 12:53923686-53923708
Sequence CTCCCTGCACAGATAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096769253_1096769257 -5 Left 1096769253 12:53923668-53923690 CCTGAGTATATGCTCCATCTCCC No data
Right 1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG No data
1096769251_1096769257 14 Left 1096769251 12:53923649-53923671 CCTTTCTTTCTGCCTGGGTCCTG No data
Right 1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG No data
1096769252_1096769257 2 Left 1096769252 12:53923661-53923683 CCTGGGTCCTGAGTATATGCTCC No data
Right 1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096769257 Original CRISPR CTCCCTGCACAGATAGGGTG TGG Intergenic
No off target data available for this crispr