ID: 1096770428

View in Genome Browser
Species Human (GRCh38)
Location 12:53932909-53932931
Sequence CCTAAAAGGGAGATAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096770428_1096770437 8 Left 1096770428 12:53932909-53932931 CCTTCCATTATCTCCCTTTTAGG No data
Right 1096770437 12:53932940-53932962 AAATTCCAGTTCCCACACCATGG No data
1096770428_1096770439 12 Left 1096770428 12:53932909-53932931 CCTTCCATTATCTCCCTTTTAGG No data
Right 1096770439 12:53932944-53932966 TCCAGTTCCCACACCATGGTGGG No data
1096770428_1096770442 19 Left 1096770428 12:53932909-53932931 CCTTCCATTATCTCCCTTTTAGG No data
Right 1096770442 12:53932951-53932973 CCCACACCATGGTGGGACTAAGG No data
1096770428_1096770444 22 Left 1096770428 12:53932909-53932931 CCTTCCATTATCTCCCTTTTAGG No data
Right 1096770444 12:53932954-53932976 ACACCATGGTGGGACTAAGGAGG No data
1096770428_1096770438 11 Left 1096770428 12:53932909-53932931 CCTTCCATTATCTCCCTTTTAGG No data
Right 1096770438 12:53932943-53932965 TTCCAGTTCCCACACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096770428 Original CRISPR CCTAAAAGGGAGATAATGGA AGG (reversed) Intergenic
No off target data available for this crispr