ID: 1096771091

View in Genome Browser
Species Human (GRCh38)
Location 12:53936583-53936605
Sequence GGACCCGTTTTCCGCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096771091_1096771105 15 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771105 12:53936621-53936643 CGGGGAGGGAGCCCCAAGAATGG 0: 1
1: 0
2: 0
3: 18
4: 450
1096771091_1096771108 20 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 250
1096771091_1096771099 -3 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771099 12:53936603-53936625 TCCGGCGTTGGGCCTGACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 45
1096771091_1096771097 -5 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771097 12:53936601-53936623 GGTCCGGCGTTGGGCCTGACCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1096771091_1096771102 1 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771102 12:53936607-53936629 GCGTTGGGCCTGACCGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 95
1096771091_1096771109 21 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771109 12:53936627-53936649 GGGAGCCCCAAGAATGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 239
1096771091_1096771098 -4 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771098 12:53936602-53936624 GTCCGGCGTTGGGCCTGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1096771091_1096771101 0 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771101 12:53936606-53936628 GGCGTTGGGCCTGACCGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 133
1096771091_1096771113 30 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771113 12:53936636-53936658 AAGAATGGGGTGGGCGTTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1096771091_1096771107 17 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771107 12:53936623-53936645 GGGAGGGAGCCCCAAGAATGGGG 0: 1
1: 0
2: 2
3: 27
4: 281
1096771091_1096771106 16 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771106 12:53936622-53936644 GGGGAGGGAGCCCCAAGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096771091 Original CRISPR GGACCCGTTTTCCGCGGGCC AGG (reversed) Intergenic