ID: 1096771108

View in Genome Browser
Species Human (GRCh38)
Location 12:53936626-53936648
Sequence AGGGAGCCCCAAGAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096771093_1096771108 15 Left 1096771093 12:53936588-53936610 CCCGCGGAAAACGGGTCCGGCGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 250
1096771091_1096771108 20 Left 1096771091 12:53936583-53936605 CCTGGCCCGCGGAAAACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 250
1096771100_1096771108 -1 Left 1096771100 12:53936604-53936626 CCGGCGTTGGGCCTGACCGGGGA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 250
1096771094_1096771108 14 Left 1096771094 12:53936589-53936611 CCGCGGAAAACGGGTCCGGCGTT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096771108 Original CRISPR AGGGAGCCCCAAGAATGGGG TGG Intergenic
900160213 1:1219741-1219763 AGTGAGCCCCAAGATGGGGCAGG - Intronic
900515651 1:3081025-3081047 AGGGAGCTCAGAGAATCGGGGGG + Intronic
900725923 1:4216331-4216353 AGGGAGGCCCAAGCAGGGGGAGG - Intergenic
900898152 1:5498252-5498274 TGGGAGACCCTAGCATGGGGAGG - Intergenic
901590640 1:10338808-10338830 AGGGAACCCCAGGAATGCTGCGG + Intronic
901887214 1:12230983-12231005 AGGGAGCTCCAAAACCGGGGCGG - Intronic
903365347 1:22802405-22802427 TGGGGACCCTAAGAATGGGGAGG + Intronic
904274465 1:29371223-29371245 CGGGAGCCCCTGCAATGGGGAGG - Intergenic
904425022 1:30417491-30417513 TGGGAGGCCCATGACTGGGGAGG - Intergenic
904531254 1:31171130-31171152 AGGGGGTCCCACGAATGGGGAGG - Intergenic
907320099 1:53596605-53596627 AGAGAGCCCCAAGACAGTGGTGG - Intronic
910318693 1:85919370-85919392 ATGGAGCCACAAGAAAGAGGGGG + Intronic
913397976 1:118393621-118393643 AAGGATCCCCAAAATTGGGGTGG + Intergenic
914667196 1:149841512-149841534 AGGGCGCAGCAAGAAAGGGGGGG - Intergenic
914668571 1:149852278-149852300 AGGGCGCAGCAAGAAAGGGGGGG + Intronic
915511949 1:156391341-156391363 AGGGAGCCCCCAAACTGGGCAGG + Intergenic
915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG + Exonic
918317131 1:183331568-183331590 AGGGAGCCCCCAGAAAGGCAGGG - Intronic
919505496 1:198393077-198393099 AGGGAGGCCCAAAACTGGGCAGG + Intergenic
920003017 1:202812177-202812199 AGGGAGCCTCCACAATGGGTGGG + Intergenic
920180914 1:204131272-204131294 AGGGAGCCAAGAGGATGGGGTGG - Exonic
921179531 1:212620845-212620867 AGGCACCCCCCATAATGGGGAGG - Intergenic
921716198 1:218419187-218419209 GGGGAGCCCTATGAATGAGGGGG - Intronic
922012596 1:221606224-221606246 AGGGAGACCCAAGGAGAGGGAGG - Intergenic
922749078 1:228062386-228062408 AGGCAGCCCCAGGAGTGGGGTGG + Intergenic
923286513 1:232501519-232501541 ATTGAGCCCAAATAATGGGGTGG + Intronic
924659451 1:246002935-246002957 AGTGAGGCCGAAGAATGGGTTGG - Intronic
1064688705 10:17891857-17891879 CGGGAGCCCCAAGGATATGGTGG + Intronic
1065252695 10:23832576-23832598 TGGGAGCCCCTAGGATGGGGAGG - Intronic
1068735031 10:60403773-60403795 AGAGAGCCACAAGATTGGAGAGG + Intronic
1069724300 10:70567411-70567433 AGGGAGCCCCTCTCATGGGGAGG + Exonic
1070967095 10:80536360-80536382 AGGGAGCAGCAGGAATGGGCCGG - Intergenic
1071117041 10:82233677-82233699 AGGGAGAAGCAAGAGTGGGGAGG - Intronic
1071430346 10:85601947-85601969 AGAAAGGCCCAGGAATGGGGGGG + Exonic
1072637779 10:97188441-97188463 AGGGAGACCCAAGAGAGGGAGGG - Intronic
1073243704 10:102074712-102074734 AGGGAGCCTAAGGAGTGGGGAGG + Intergenic
1073472639 10:103732570-103732592 AGGGAGCCCAAAGTCTGGGGAGG + Intronic
1075097456 10:119481882-119481904 AGGGAGCTCCATGAGTGTGGAGG + Intergenic
1076732125 10:132444255-132444277 AGGGAGCCCTGAGGAAGGGGAGG - Intergenic
1077543548 11:3159024-3159046 ATGGGGCCCCAAGAATGGCAGGG - Intronic
1077631801 11:3816278-3816300 AAGGAGACCCAGGAATGGGGTGG - Intronic
1079264187 11:18914532-18914554 AGGAAGCCCCAGGAATTAGGAGG + Intergenic
1081698742 11:45138166-45138188 AGGGAGCCCAATGAACAGGGGGG + Intronic
1082911119 11:58375696-58375718 ATGGAGCCCCAAGGCTGGAGAGG - Intergenic
1083333993 11:61912363-61912385 AGGGAGTCCCAGGAAAGGGTTGG + Intronic
1085464012 11:76712233-76712255 AGGGACAGCCAAGAAAGGGGAGG + Intergenic
1088541591 11:110919164-110919186 AGGGAGCCCAAAAGATAGGGAGG + Intergenic
1090351489 11:126111210-126111232 AGGGACTGCCAAGAATTGGGTGG - Intergenic
1091080876 11:132666468-132666490 TGTGAGCCCCAAGATTGGAGTGG - Intronic
1091429298 12:419200-419222 AGGGAGCACTAAGGATAGGGTGG + Intronic
1094499936 12:31012250-31012272 AGGGAACCCCCAGGATGGGGAGG + Intergenic
1095715938 12:45345968-45345990 AGGGAGAAACAAAAATGGGGCGG + Intronic
1096670111 12:53193526-53193548 AGGGAGCCCCAGTCAGGGGGAGG + Exonic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1098337858 12:69422112-69422134 AGAGAGGTCCAAGAAGGGGGTGG + Intergenic
1102734014 12:115141289-115141311 AGGGAGCGCCCAGAATTTGGGGG - Intergenic
1103743445 12:123106812-123106834 AGAGAGCCCAGAGCATGGGGAGG - Intronic
1109547019 13:63843865-63843887 TGGGAGTCCCAAGAATCAGGGGG - Intergenic
1112098186 13:96158378-96158400 AGGGAACCCCAAGAAAAAGGTGG + Intronic
1112401237 13:99080309-99080331 AGGCAGGCCCAAGAATGGGATGG - Intronic
1112414769 13:99195125-99195147 AGGAAGCCCCAAGGATAAGGGGG - Intergenic
1112482601 13:99790797-99790819 AGGGAATCCCCAGAATGGTGGGG - Intronic
1113620106 13:111756491-111756513 AGAGACCCCCAGGAGTGGGGAGG + Intergenic
1114590454 14:23860003-23860025 AGGGAGCCCAGAAAATGGAGGGG - Intergenic
1119543764 14:75457328-75457350 AAGGAGCCCCAAGAAGGGCTGGG + Intronic
1119681446 14:76595236-76595258 ACGGACCCCCAGCAATGGGGAGG - Intergenic
1119946228 14:78697647-78697669 AGGGAGTCCCAAGAAAGGAGGGG + Intronic
1121329157 14:93039207-93039229 AGGGAGCCCAAAGCATGCTGGGG - Intronic
1121968954 14:98338859-98338881 AGGGAGCTCTAAGATTGGGGAGG + Intergenic
1122309462 14:100785372-100785394 AGGGAGCTCCAAGGATGCGGAGG - Intergenic
1125410054 15:39396578-39396600 AGTGAGTTCCAAGATTGGGGTGG + Intergenic
1126070170 15:44859087-44859109 AGAGAGCCCCAACACTGGAGGGG - Intergenic
1126087866 15:45026006-45026028 AGAGAGCCCCAACACTGGAGGGG + Intronic
1127272531 15:57414216-57414238 AGGGAGCCCAAAGGATGAAGGGG - Intronic
1129303704 15:74642763-74642785 AGAGAGCCCTCAGAATGAGGGGG - Intronic
1129726870 15:77905915-77905937 AAGAATGCCCAAGAATGGGGAGG + Intergenic
1130211531 15:81927263-81927285 AGGGAGCCACAAGGATGGCTGGG + Intergenic
1131435690 15:92419647-92419669 AGGGAGCTCCAAAATTGGGATGG + Intronic
1131456401 15:92585698-92585720 AGGGACCCCCAATTATGGAGAGG + Intergenic
1132888743 16:2194201-2194223 AGGCAGGCCCAAGAATGCCGTGG - Intronic
1133160565 16:3908965-3908987 AGGGATACCCACGAATGGCGAGG + Intergenic
1133471529 16:6080485-6080507 AGGGAGCCTCAAGTCTGGAGGGG + Intronic
1133969010 16:10553690-10553712 AGGCAGCCCAAGGAATGAGGTGG - Intronic
1134627022 16:15729488-15729510 AATGAACCCCAAGCATGGGGAGG + Intronic
1136008698 16:27348356-27348378 AGAGAGTCCCAAGGATGGGCTGG + Intronic
1138518362 16:57552939-57552961 AGGGAGGCCCAAGAAGAGGGAGG + Intronic
1138558695 16:57787520-57787542 ATGGAGGCCCCAGAAAGGGGAGG + Intronic
1138907456 16:61354381-61354403 AGGGAGACCCAGGCATGAGGGGG + Intergenic
1140200194 16:72888667-72888689 AGGGAGCTTCAAGAAAGGGCTGG + Intronic
1143103078 17:4514682-4514704 AGGGAGACCCAGGAAGGGGTAGG - Intronic
1143305320 17:5941918-5941940 ACGGAGCCCAAGAAATGGGGAGG - Intronic
1143526581 17:7476639-7476661 AGGGAGGGCCAAGAAGGAGGTGG - Intronic
1143714567 17:8757666-8757688 AGAGAGCCGGAAGAATGGGGAGG - Intronic
1144096408 17:11904325-11904347 GAGGAGCCACAAGAGTGGGGAGG + Intronic
1144159798 17:12546714-12546736 AAGATGCCACAAGAATGGGGTGG - Intergenic
1145811588 17:27767501-27767523 AGGGAGCCCCAGGAGGGTGGTGG - Intronic
1145978228 17:28996530-28996552 AGTGAAGCCCAAGATTGGGGAGG + Intronic
1145981110 17:29012212-29012234 AAGGAGCACCCAGACTGGGGAGG + Intronic
1146014205 17:29219490-29219512 AGGGAGTCCCAAGGAAGGGAGGG - Intergenic
1146841869 17:36161927-36161949 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1146854179 17:36249887-36249909 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1146870083 17:36373779-36373801 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1146877440 17:36424860-36424882 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1147072964 17:37974403-37974425 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1147084486 17:38053941-38053963 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1147100433 17:38177907-38177929 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1148683316 17:49486886-49486908 GGGGAGCCCCAGGTCTGGGGAGG - Intergenic
1150083374 17:62260953-62260975 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1151834504 17:76574118-76574140 AGGGAGGCCCCAGGATGGTGAGG + Intronic
1151887467 17:76931724-76931746 AGAGAGCCACAGGAATGAGGAGG + Intronic
1152017466 17:77761108-77761130 GGGGAGCCCCAAGTAGGGGACGG + Intergenic
1152367093 17:79862561-79862583 AGGGAGACCCAAGGGTGGGTCGG + Intergenic
1158488741 18:57891329-57891351 AGAGAGCAACCAGAATGGGGTGG - Intergenic
1159954806 18:74511732-74511754 AGGCAGCACCAAGAGTGGGAAGG + Intronic
1160184015 18:76660693-76660715 AGGGAGAGACCAGAATGGGGAGG + Intergenic
1162086615 19:8253289-8253311 GGGGAGCCCCTAGACTGGCGGGG + Intronic
1162417211 19:10545022-10545044 AGGCAGCCCCCAGGAAGGGGCGG - Exonic
1163648443 19:18503385-18503407 AGGGAGCCCCAGCAAGTGGGGGG + Intronic
1164698296 19:30263084-30263106 AGTGAGCCCCGAGAAGGAGGTGG + Intronic
1166782196 19:45348617-45348639 GGGGCGCCCCAGGAATGGAGGGG - Intronic
1167945630 19:52986365-52986387 AGGGAGTCCCTCCAATGGGGCGG + Intergenic
1168293535 19:55368599-55368621 AGGGAGCCCCGAGGCTGGGCAGG - Intronic
925188309 2:1864383-1864405 AGGGAGCGGCAAGACTGTGGAGG - Intronic
925255396 2:2481479-2481501 AGGGAGCCCGAATAGTGGTGTGG - Intergenic
925389843 2:3487239-3487261 CGGCAGCCTCCAGAATGGGGAGG - Intergenic
926315127 2:11704095-11704117 TGGCATCCCCCAGAATGGGGAGG + Intronic
928009656 2:27595113-27595135 AGGGAGACCGAAGAAGGGAGAGG + Intronic
929437368 2:41938959-41938981 AGGGTGCCCCAGGTGTGGGGAGG - Intronic
929567217 2:42996759-42996781 AGGGAGCACCCACACTGGGGTGG + Intergenic
931044423 2:58334451-58334473 AGGGCGCCTCAGGAAGGGGGTGG + Intergenic
933247574 2:79993343-79993365 TGGGAGCCCAAAAAATGGAGAGG - Intronic
935490654 2:103716344-103716366 AGGGAGCTCCCAGAGTGGGAGGG + Intergenic
936010830 2:108924324-108924346 TGGGAGCCCCAAGGAGAGGGTGG - Intronic
937992470 2:127672351-127672373 AGGCAGCCCAGAGCATGGGGTGG - Intronic
939674023 2:145049604-145049626 AGGAAGCCTGAACAATGGGGAGG + Intergenic
939757309 2:146130464-146130486 AGGGAGCCTCACGCATGGTGTGG - Intergenic
939960520 2:148561443-148561465 TGGGAGCGCCAAGAATGTGCTGG + Intergenic
945004779 2:205392948-205392970 AGGGACCCCCAAAAAGGGGTTGG + Intronic
947524712 2:230871136-230871158 TGGGAGACCCGAGAAGGGGGAGG + Intronic
948976665 2:241467737-241467759 AGCGAGCCCTAAGACTGGGCAGG + Intronic
1169844613 20:9976161-9976183 AGGGAGCCCCAAAAAATTGGAGG + Intergenic
1172512318 20:35509214-35509236 AAGGAGGCCCAACATTGGGGTGG + Intronic
1174580912 20:51570871-51570893 AGGGAGCCCCGTGGATGGGCAGG - Intergenic
1175564573 20:59962887-59962909 AGAGAGCCCCCAGGATGGGCAGG + Intronic
1176863433 21:14027613-14027635 AGGGCGTCCCGAGACTGGGGAGG + Intergenic
1178470473 21:32887848-32887870 TGGGAACCCCAAGAATGTGGAGG - Intergenic
1179109093 21:38430636-38430658 AGGGGGCCCCAAGAGGTGGGGGG + Intronic
1180088873 21:45523841-45523863 TCGGGGCTCCAAGAATGGGGAGG + Intronic
1182050414 22:27308853-27308875 AGGAAGCCCCAAGATGGGAGTGG - Intergenic
1182582700 22:31324431-31324453 AGGGTGACCCTAGAATGTGGAGG - Intergenic
1183374191 22:37453544-37453566 AGGGAGGCTAAAGAATGAGGTGG - Intergenic
1183614636 22:38936457-38936479 AGGGAGCCCAGAGAAAGGGCAGG + Intergenic
1185246351 22:49775271-49775293 AGGGACCCCCAACACTGGAGCGG + Intronic
949305821 3:2639479-2639501 AGGGAGCTCCATGAATGTGGAGG - Intronic
950422540 3:12907363-12907385 AGGCAACCCCAGGAATGGGGGGG + Intronic
954213059 3:49109091-49109113 TGGGGGCCCCAAGACTGGGTGGG - Exonic
954238920 3:49277985-49278007 ATGGATCCCGAAGAATGGAGAGG - Intronic
954400934 3:50319222-50319244 ACTGAGCCCCAAAAGTGGGGTGG - Intronic
954568048 3:51615709-51615731 AGTGAGCCCCAGCAGTGGGGAGG + Intronic
960873737 3:122276171-122276193 AGGGAGCCCCAAGATTGCAAAGG - Intronic
961825779 3:129598342-129598364 CAGGAGCCCCCAGAATGGTGAGG - Intronic
962016263 3:131443605-131443627 AGGGAGCAAGAAGAATGAGGCGG + Intergenic
962251202 3:133837073-133837095 AGGGTGCCCGAGGTATGGGGAGG - Intronic
964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG + Intergenic
966919108 3:184601066-184601088 AGGGAGCCCCACCTCTGGGGAGG + Intronic
967864057 3:194175806-194175828 AGGGAGCCCCCAGCATGGAGAGG - Intergenic
968401912 4:305271-305293 AGGGCGTCCCAAGGCTGGGGAGG - Intronic
968419757 4:473943-473965 AGGGCGTCCCAAGGCTGGGGAGG - Intronic
968513178 4:1004144-1004166 CCTGAGGCCCAAGAATGGGGTGG - Intronic
969503931 4:7571669-7571691 AGGGAGCCCGAAGAAATTGGGGG + Intronic
971209531 4:24602455-24602477 TGGGAGCCCCAGGAATAGGGTGG - Intergenic
973645657 4:52949009-52949031 AGGCAGCCCCAAGACTGGACTGG + Intronic
975095882 4:70455893-70455915 AGGGAGGCACAAGAAGAGGGTGG - Intronic
977721114 4:100241497-100241519 AGAGAGCACCAACCATGGGGTGG - Intergenic
978600098 4:110418798-110418820 TGGGCGCGGCAAGAATGGGGAGG + Intronic
981005340 4:139869012-139869034 AGGGAGCCACAGAAATGGGTGGG + Intronic
981081945 4:140644896-140644918 AGGGAGCCCCCAGGCTGGGTGGG + Intronic
984704356 4:182836909-182836931 AAGGAGCACCAAGATAGGGGAGG - Intergenic
985534129 5:453719-453741 TGGGAGGCCCAAGAATTGGAAGG + Exonic
986061147 5:4192243-4192265 AGGGAGCCCACAGAAGGGAGCGG - Intergenic
986343014 5:6808394-6808416 AGTGAGCTCAAAGGATGGGGTGG + Intergenic
990148149 5:52786859-52786881 AAGGAGCGTCAAAAATGGGGTGG - Intergenic
990369969 5:55107806-55107828 AGTGAGCCCCAAGAATGACCTGG - Exonic
991655636 5:68901584-68901606 AGGGAGGCAGAAGCATGGGGAGG - Intergenic
998113519 5:139519744-139519766 AGGGAGCTCCCAGAAAGGTGTGG + Intergenic
998149779 5:139750400-139750422 AGGGAGCAACAGGAATGGGCAGG - Intergenic
998177534 5:139911134-139911156 GAGCAGCCCCAACAATGGGGTGG + Intronic
1000050772 5:157561312-157561334 AGAGATCGCCAAGAATGGTGAGG - Intronic
1000597221 5:163229968-163229990 GGGTAGACCCAAGAATGTGGTGG - Intergenic
1001260468 5:170224184-170224206 AGGTAGTCTCAAGAATGGAGGGG + Intergenic
1001425274 5:171618519-171618541 GGGCAGCCCCAGGAAAGGGGAGG - Intergenic
1002292500 5:178209502-178209524 AGGGAGCCCCAAGACAGGCTTGG - Intronic
1002855911 6:1038131-1038153 AGTGAGCAGCAAGAAGGGGGCGG + Intergenic
1003785938 6:9487095-9487117 AGGGAGCCACCAGAATGCTGAGG - Intergenic
1004302121 6:14468112-14468134 AGGGAGCTCAAATTATGGGGAGG + Intergenic
1004785383 6:18962530-18962552 AGGCAGACACAAGAAAGGGGAGG + Intergenic
1005896796 6:30185723-30185745 AGGGGGCCACAGCAATGGGGAGG + Exonic
1006403609 6:33831665-33831687 TGGGGGCCCCAAGCATGGCGGGG + Intergenic
1006412419 6:33882110-33882132 ATGGAGCCCCAAGAAAGGAATGG - Intergenic
1007704878 6:43784450-43784472 AGGGGCCCCCAGGAATGGGGAGG + Intronic
1007729298 6:43936107-43936129 AGGGAGGCGCCAGAATGGGAGGG + Intergenic
1009307094 6:62103633-62103655 AGGGAGCCCCATTGTTGGGGTGG - Intronic
1009940420 6:70282674-70282696 AGGGAGGACCCAGATTGGGGAGG + Intronic
1018288342 6:162264635-162264657 TGGGAGCTCTGAGAATGGGGAGG - Intronic
1019278553 7:188663-188685 TGGGTCCCCCAGGAATGGGGGGG - Intergenic
1019278566 7:188692-188714 TGGGATCCCCAGGAATGAGGGGG - Intergenic
1019401782 7:858815-858837 AGAGAGCCCCTATAATGGGTAGG + Intronic
1019867451 7:3725618-3725640 CAGGAGCCCCAAGAACAGGGAGG + Intronic
1020045432 7:5036883-5036905 AGAGAGATGCAAGAATGGGGAGG - Intronic
1023108035 7:36782335-36782357 AGGCAGACCCAGGAGTGGGGTGG - Intergenic
1024868783 7:53937280-53937302 AAGAAGCCCCAGGAATGGGAAGG - Intergenic
1028390592 7:90311921-90311943 AGGGAACCCTAAGCATGGGTAGG + Intergenic
1029181536 7:98705440-98705462 TGGGAACACCAAGAGTGGGGAGG - Intergenic
1029298175 7:99558325-99558347 AGGGAGTCTCAAGGATGGGCTGG + Intronic
1030117008 7:106069743-106069765 TGGGAGCCCATAGAATGGGTAGG + Intergenic
1033185540 7:139224884-139224906 AGGGAGACCGAAGAAGGGAGAGG - Intergenic
1033439338 7:141364733-141364755 AGGTAACCCAAAGAATGGAGTGG + Intronic
1034445749 7:151113428-151113450 AGGGAGCACCTAGGATGGAGAGG + Intronic
1034496890 7:151428492-151428514 AGGGAGGCCCAGGAAGGGGAAGG + Intergenic
1034725431 7:153331345-153331367 AGTGAGCCCAGAGAATTGGGAGG - Intergenic
1035104993 7:156434843-156434865 AGGAAGCAGCAAGAATGAGGTGG + Intergenic
1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG + Intergenic
1036217316 8:6891471-6891493 AGGGAGCTTGAAGAATGGGTAGG + Intergenic
1037709969 8:21347686-21347708 AGGGCCAACCAAGAATGGGGAGG - Intergenic
1038174321 8:25166400-25166422 AGGGAGGCCTAATGATGGGGAGG - Intergenic
1038258220 8:25970520-25970542 GGGGAGCCTGAAGAGTGGGGAGG - Intronic
1039804991 8:40990177-40990199 AGGGGGCGCTATGAATGGGGTGG + Intergenic
1040581029 8:48698755-48698777 TGGGAGCGACAGGAATGGGGAGG - Intergenic
1043960862 8:86416970-86416992 AGTGAGTCCCCAGAATGTGGTGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046703442 8:117426189-117426211 AGGGAGACCAAAGAAGGGAGAGG - Intergenic
1048852419 8:138657776-138657798 AGGATGCACCGAGAATGGGGAGG - Intronic
1048951672 8:139501665-139501687 AGAGAGCCCCAAGAGTGATGTGG - Intergenic
1049187716 8:141267025-141267047 AGGGAGCCCCAGGACAGCGGTGG + Intronic
1049262906 8:141649269-141649291 AAGCAGCGCAAAGAATGGGGAGG - Intergenic
1049424995 8:142534029-142534051 AGGGGGACCCAGGAAGGGGGAGG - Intronic
1049539339 8:143200502-143200524 AGGGAGCCCCAGGGCTGGCGCGG - Intergenic
1049554393 8:143274897-143274919 AAGGGGCCCCAGGAAGGGGGTGG - Intronic
1050509298 9:6376996-6377018 AGGCACCCCCCAGAAGGGGGTGG + Intergenic
1051002790 9:12305250-12305272 TGGGAGACCAAAGAATAGGGAGG + Intergenic
1054142456 9:61540193-61540215 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054191092 9:61986223-61986245 AGGCAGCCCCAAGCCTGGGTGGG + Intergenic
1054462200 9:65471343-65471365 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054647277 9:67601494-67601516 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054855788 9:69898222-69898244 AGGGAGGCTGAAGAATGTGGTGG - Intronic
1055256675 9:74379997-74380019 TGGAAGGCCCAAGAAGGGGGTGG - Intergenic
1055604701 9:77956636-77956658 ACAGAGCCCCAGGAAGGGGGAGG + Intronic
1056565917 9:87772012-87772034 AGGGATCCCCAATAATTGGGAGG - Intergenic
1056597789 9:88021805-88021827 ATGGAGACCCAAGAATATGGCGG - Intergenic
1056730920 9:89166168-89166190 ATGGAGCCCAAATAATGGGTGGG - Intronic
1059057134 9:110995658-110995680 AGGGAGCACCAAGAAAGAGCTGG + Intronic
1060523160 9:124305748-124305770 GGAGAGCCCAGAGAATGGGGAGG + Intronic
1060634457 9:125189313-125189335 CGGGAGACCCAGGGATGGGGTGG + Intronic
1060821581 9:126664393-126664415 AGACAGCCCCAGGGATGGGGGGG + Intronic
1060924425 9:127446141-127446163 AGGAAGCCCCGAGAATGGGGAGG + Intergenic
1061263500 9:129492680-129492702 AGGGATGCCCAAGAGTTGGGTGG - Intergenic
1062008992 9:134257065-134257087 AGGGAGCCCCGAGGCTGGAGTGG + Intergenic
1062460540 9:136660935-136660957 AAGGACCCACAAGCATGGGGTGG - Intronic
1062634737 9:137484864-137484886 AGGCAGCCTCAGGACTGGGGAGG - Intronic
1062634749 9:137484897-137484919 AGGCAGCCTCAGGACTGGGGAGG - Intronic
1062634758 9:137484930-137484952 AGGCAGCCTCAGGACTGGGGAGG - Intronic
1185620887 X:1451662-1451684 CGGGACCCCTAGGAATGGGGAGG - Intronic
1185621190 X:1452446-1452468 CGGGACCCCTAGGAATGGGGAGG - Intronic
1187278188 X:17834923-17834945 AGAGAGCCACAAGAAGAGGGAGG + Intronic
1189702970 X:43730886-43730908 AGGGAGCCCTGAGAAGGGGCAGG - Intronic
1190663411 X:52676117-52676139 AGGGAGGCCCAAGAAAAGGAAGG + Intronic
1190676012 X:52782365-52782387 AGGGAGGCCCAAGAAAAGGAAGG - Intronic
1192038131 X:67588037-67588059 TGGAAGCCCCCAGAATTGGGAGG - Intronic
1192171852 X:68860662-68860684 AGGGTGCCCCAGGAATGTGGAGG + Intergenic
1193969936 X:88038961-88038983 ATGGAGCTCCAGGATTGGGGAGG - Intergenic
1195323672 X:103741066-103741088 AGTGGGGCCCAAGAATGGTGGGG - Intergenic
1196845913 X:119896532-119896554 AGGGAGGCTTAAGAATGGTGTGG + Intronic
1200060798 X:153482878-153482900 CTGGAGCCCCCAGGATGGGGAGG + Intronic