ID: 1096771731

View in Genome Browser
Species Human (GRCh38)
Location 12:53939655-53939677
Sequence CCCGAGCGCCGCCGCCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 1, 2: 6, 3: 70, 4: 499}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096771718_1096771731 15 Left 1096771718 12:53939617-53939639 CCACCTCTGGAAGTCTCCCTTCC 0: 1
1: 0
2: 2
3: 32
4: 318
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771727_1096771731 -7 Left 1096771727 12:53939639-53939661 CCAGGTAAGGAAGGGACCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771719_1096771731 12 Left 1096771719 12:53939620-53939642 CCTCTGGAAGTCTCCCTTCCCAG 0: 1
1: 0
2: 2
3: 46
4: 582
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771725_1096771731 -2 Left 1096771725 12:53939634-53939656 CCTTCCCAGGTAAGGAAGGGACC 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771717_1096771731 16 Left 1096771717 12:53939616-53939638 CCCACCTCTGGAAGTCTCCCTTC 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771716_1096771731 19 Left 1096771716 12:53939613-53939635 CCGCCCACCTCTGGAAGTCTCCC 0: 1
1: 0
2: 3
3: 50
4: 395
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771726_1096771731 -6 Left 1096771726 12:53939638-53939660 CCCAGGTAAGGAAGGGACCCGAG 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499
1096771724_1096771731 -1 Left 1096771724 12:53939633-53939655 CCCTTCCCAGGTAAGGAAGGGAC 0: 1
1: 1
2: 1
3: 22
4: 186
Right 1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG 0: 1
1: 1
2: 6
3: 70
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096771731 Original CRISPR CCCGAGCGCCGCCGCCGCCG GGG Intronic
900221488 1:1511733-1511755 CCCGGGCGCCGGTGCCGCCTCGG + Intergenic
900578038 1:3393999-3394021 CCCTGGAGCCGCCGCCGCCGCGG - Intronic
900786924 1:4655221-4655243 CCGGCGCGCCGCCGCCGTTGGGG - Exonic
901551387 1:9997949-9997971 CCCGACCGCCGCCTCCCACGAGG + Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
902323566 1:15684296-15684318 TCCTGCCGCCGCCGCCGCCGCGG + Intergenic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902870741 1:19312278-19312300 ACCGCGCGCCACCGCCCCCGCGG - Intergenic
903750213 1:25616799-25616821 CCCGAGCGGCGGCGGCGGCGGGG + Intergenic
903883764 1:26529773-26529795 GCCGTCCGCCGCCGCCGCCGCGG - Intronic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
904837737 1:33349868-33349890 CTCGAGGGCTGCAGCCGCCGCGG + Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905546439 1:38804055-38804077 CCCCAGCCCGGACGCCGCCGAGG - Intergenic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906534519 1:46544177-46544199 GCCCATCGCTGCCGCCGCCGGGG - Intergenic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
908127175 1:61043393-61043415 CCCGCGCCCCGCTGCCGTCGTGG - Intronic
908131843 1:61082376-61082398 CGCTCGCGCCGCCGCCGCGGGGG - Intronic
908605522 1:65793171-65793193 CCAGAGCGCTGCGGCCGCGGCGG + Intronic
909075645 1:71047736-71047758 CCCTGGCGCCGCCGCGGCCGCGG - Exonic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
914900001 1:151706711-151706733 CCAGAGCCCCGCGGCCCCCGTGG - Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915572383 1:156751559-156751581 CCCGAGCTCCGGCGCGGCCACGG + Intronic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916107004 1:161440286-161440308 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916108565 1:161447700-161447722 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916110153 1:161455081-161455103 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916111738 1:161462491-161462513 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916113325 1:161469872-161469894 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
919705332 1:200669991-200670013 GCCGAGCTCCGCCCCCGCGGTGG - Intergenic
919789653 1:201283070-201283092 CCCGGGAGCCTCCACCGCCGGGG + Intergenic
920002376 1:202808484-202808506 GCCGTGCGCCTCCGCCGCCACGG + Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
922502933 1:226110224-226110246 CCCCAGCCCGGCCTCCGCCGCGG - Intergenic
922753740 1:228082874-228082896 CCCTGTCGCCGCCGCCGCCGCGG - Intronic
923126682 1:231039986-231040008 CCCGGGCCCCGCCGCCGCCCGGG + Exonic
923461765 1:234214706-234214728 GCAGAGCGCCGCCGCCTGCGTGG + Intronic
923684195 1:236142593-236142615 CACGGCCGCCGCCGCCCCCGCGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1062932682 10:1363288-1363310 CCCGACCCCCGCCACCCCCGCGG - Exonic
1063657810 10:8009252-8009274 CCCGGGTCCCGCCGCCTCCGGGG + Exonic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064086507 10:12349656-12349678 CGCTCTCGCCGCCGCCGCCGCGG - Exonic
1064231015 10:13529131-13529153 CCCGGGGGCCGCCGCCGGCCTGG + Intergenic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1065807656 10:29409787-29409809 CCCGAGCCCGGCCGCCATCGTGG - Intergenic
1067105339 10:43362559-43362581 CCCGAGGGTCGTCGCTGCCGGGG + Intergenic
1070112090 10:73495957-73495979 GCCAAGCGGCGGCGCCGCCGGGG + Exonic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071055340 10:81503126-81503148 CCCGAGCCTCCCCGCCGCCTGGG + Intergenic
1072654622 10:97321173-97321195 CACGCGCGTCGCCGCCACCGCGG + Exonic
1072667020 10:97401055-97401077 CCCGAGCGCAGCCGGGGGCGGGG - Intronic
1073266369 10:102230681-102230703 CTCGGCCGCCGCCGCCGCCGCGG - Exonic
1073325740 10:102643407-102643429 CCAGACCCCGGCCGCCGCCGCGG + Intergenic
1074772410 10:116742536-116742558 CCCGAGCGCCGCCGCGGACGCGG - Exonic
1075129540 10:119726225-119726247 CCCGCGGGCCGCCGCCTCCCTGG + Exonic
1075430298 10:122374772-122374794 CCGGAGCACCCGCGCCGCCGCGG - Exonic
1075885480 10:125896183-125896205 CCCGACCCCTTCCGCCGCCGGGG + Intronic
1076116962 10:127907443-127907465 CCCCGGCCCCGCCGCCCCCGCGG + Intronic
1076487444 10:130833769-130833791 CCCCACCTCCCCCGCCGCCGAGG - Intergenic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076792536 10:132784927-132784949 CCCCCGCGCCGCCGCCGCACGGG + Exonic
1077021071 11:417400-417422 CCGGGGCTACGCCGCCGCCGGGG - Intronic
1077065590 11:639737-639759 TACGGGCGCCGCCACCGCCGCGG - Exonic
1077098536 11:810368-810390 CCCTTGCCCCGCAGCCGCCGTGG + Intronic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1078246101 11:9574150-9574172 CCCGAGCGCCGCCGCTCGCCCGG + Exonic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1078986660 11:16605062-16605084 CCCGAGCCCGGCCGCTCCCGCGG - Intronic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1081805011 11:45885721-45885743 CGAGAGGGCAGCCGCCGCCGCGG - Exonic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084000179 11:66291859-66291881 CCCGAGCGCGGCGGCAGCGGCGG - Exonic
1084212284 11:67629804-67629826 CACGAGCACCGCGGCCGACGCGG + Exonic
1084310333 11:68312878-68312900 CGCGGGCGCCGCCGCCGTCTCGG + Intronic
1084546752 11:69818611-69818633 CCCCGGCGCCGCCTCCCCCGCGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087241824 11:95789538-95789560 CCCGAGAGCCGCCGCCGCCCGGG + Exonic
1088314923 11:108498100-108498122 CCCGCGCGTCCCCGCCGCCCGGG - Intronic
1089499922 11:118925842-118925864 GCCGCGCGCCGCCGCCTCCCCGG + Intronic
1089796616 11:120986156-120986178 CCCGAGTGCCGCCGCTTCCAGGG + Exonic
1090699248 11:129279436-129279458 CCCGGGGGCCGACTCCGCCGCGG - Intergenic
1091558654 12:1594365-1594387 GCCGGCCGCCGCCGCCGCCTCGG + Intronic
1091700023 12:2653021-2653043 CCCGGGCGCCGCTTCAGCCGTGG - Intronic
1093164568 12:15789786-15789808 CCCGAGCGCTCCCTCCGCCCGGG - Intronic
1094025804 12:25958832-25958854 CCCCAGCGCCAACGCCGCCGCGG - Intergenic
1095476252 12:42589825-42589847 GCGGAGCGCGGACGCCGCCGCGG + Intronic
1096073567 12:48788936-48788958 CCCCCGCCCCGCCGCCCCCGCGG + Intronic
1096489663 12:52006812-52006834 CCCGCGAGGCGCCGCCGCCCTGG - Intergenic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1100391311 12:94148361-94148383 GCCGCCCGCCGCGGCCGCCGCGG - Intergenic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101716634 12:107318435-107318457 CCGGAGCGCAGCAGCGGCCGTGG - Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1102893009 12:116575904-116575926 CCCTCGCGTCGTCGCCGCCGCGG + Exonic
1103364018 12:120369341-120369363 TCCCGGCGCCGCCGCCTCCGCGG - Intergenic
1103386272 12:120534780-120534802 TCCGACTGCCGTCGCCGCCGAGG + Exonic
1103528051 12:121580480-121580502 CGCAGGCGCCGCCGCCGCCCGGG + Intronic
1103563596 12:121804671-121804693 AGCGGCCGCCGCCGCCGCCGCGG + Intronic
1103718408 12:122959988-122960010 CACGAGGCCCGCAGCCGCCGGGG + Exonic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1105492548 13:20902718-20902740 CCCCAGCGCCGCCGCCATCATGG + Exonic
1105698592 13:22915769-22915791 CCGGCGCGCCGCCTCTGCCGCGG + Intergenic
1105943425 13:25170731-25170753 CCCGGGCGCCGGTGTCGCCGGGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1107133327 13:36919686-36919708 CCCGACCGCCGCCCCCGCCGCGG + Intronic
1107133432 13:36920057-36920079 CCCCAACCCCGCCCCCGCCGTGG + Intronic
1107468027 13:40666652-40666674 CGCGCGCGCCGCCGCGGGCGGGG - Intergenic
1107935227 13:45340846-45340868 CCCGCGTGCGGCCGCCGGCGCGG - Intronic
1108690019 13:52851297-52851319 TCCCGGCGCCGCCGCCGTCGTGG - Intergenic
1109638064 13:65149673-65149695 CCCGAGCCTCCCCACCGCCGAGG - Intergenic
1110630107 13:77697882-77697904 CGAGGGCGCCGCGGCCGCCGGGG - Intronic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1112507241 13:99982339-99982361 CCCGAGCGCTGCGGCCGCAGCGG - Exonic
1113494020 13:110713921-110713943 CCCGGGAGCCACCGCCACCGCGG + Intronic
1114663700 14:24366793-24366815 CCGGAGCTCCGCAGCGGCCGAGG - Intronic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1116657926 14:47674744-47674766 TCCGCTCGCCGCCGCCGCCGGGG - Exonic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1117803135 14:59465068-59465090 CCCCAGCGCCGCGGTCGCCACGG + Exonic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119223963 14:72929839-72929861 CCCAGGCACAGCCGCCGCCGCGG - Intronic
1119318435 14:73714442-73714464 CCCGAGCAGCTCCGCCGCGGGGG - Intergenic
1122162273 14:99793244-99793266 CCCGGGCCCCGCGGCCGCCGAGG + Intronic
1122231203 14:100306984-100307006 CCCGGAGGCCACCGCCGCCGCGG - Intergenic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122947731 14:105020863-105020885 CCCGGGCGCCGCCTCCGCCCCGG + Intronic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG + Exonic
1202872578 14_GL000225v1_random:177734-177756 CCCGACCCCTTCCGCCGCCGGGG - Intergenic
1125033172 15:35093140-35093162 CCCGTCCGCCGCCGCCGCCTGGG - Intergenic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126724976 15:51622728-51622750 CTCGACCGCCGCCGCCGCCCGGG + Intronic
1127165773 15:56243811-56243833 TCCCGGCCCCGCCGCCGCCGCGG + Intergenic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1129447011 15:75625684-75625706 CGCACGCGCCGCCGCCACCGGGG + Exonic
1129823684 15:78620747-78620769 CCCTGGCGCTGTCGCCGCCGCGG - Exonic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1130305355 15:82709488-82709510 CCCCAGCGCCGGCCCCGCCCCGG - Intronic
1130411723 15:83653830-83653852 GCCGAGTCCCGCCGTCGCCGCGG + Intergenic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1131827042 15:96330475-96330497 CGCGAGCGGCGTCGCCGGCGCGG - Intronic
1132028534 15:98422059-98422081 CCGGTGCGCCGCCGCCGATGGGG + Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132365152 15:101251650-101251672 CACGCCCGCCCCCGCCGCCGCGG + Exonic
1132588144 16:715116-715138 CCCCAGCGCCGGGGCCGCCTTGG - Exonic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1133220141 16:4316233-4316255 CCCGACCGCCCCCGCCGCTGAGG + Intronic
1133259308 16:4538207-4538229 CCCGGGCCCCGCCACCGCAGCGG + Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1133513424 16:6483222-6483244 CCCGGGCCCTGGCGCCGCCGTGG + Intronic
1133784561 16:8964026-8964048 CCCGCCTGCCGCCGCCGCCGAGG + Intronic
1135572282 16:23558037-23558059 CTCGGCCGCCGCCCCCGCCGCGG - Exonic
1135691318 16:24539913-24539935 CCCCGCCGCCGCCGCCGCCTCGG - Intronic
1136486054 16:30572267-30572289 CCCGAGCACCGCAGATGCCGAGG - Exonic
1136497902 16:30655079-30655101 CCCGAGCCCCGCCACCCCCTCGG + Exonic
1137268074 16:46884784-46884806 CCAGAGCAGCGCGGCCGCCGAGG + Exonic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1137708015 16:50548611-50548633 CCCCGCCGCCGTCGCCGCCGCGG + Intronic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1139664891 16:68448451-68448473 CGCGAGAGCCGCCGCCGCTGCGG - Exonic
1141578590 16:84981825-84981847 CCCGAGCGCATCCGCCACTGCGG - Intronic
1141831013 16:86510089-86510111 GCCGAGCGCCGCGGGCGGCGGGG + Intergenic
1142136283 16:88453360-88453382 CGCACTCGCCGCCGCCGCCGCGG - Exonic
1142163334 16:88570628-88570650 CGCGGCCGCCGCCGCCGCCTCGG - Intronic
1142240228 16:88941504-88941526 CCCCAACGCCTCCGCCACCGGGG + Intronic
1142350098 16:89575829-89575851 CCCGCGAGTCGGCGCCGCCGCGG - Exonic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1142610830 17:1108643-1108665 CCCGAGCCTCGCCGCCTCCCTGG - Intronic
1142811801 17:2399023-2399045 GCCGTGTGCCGCCGCCGCGGCGG - Intronic
1142848377 17:2692751-2692773 CGCGAGTGCCGCCCGCGCCGGGG - Intronic
1143007456 17:3846158-3846180 CCCCAGGGCCGGCCCCGCCGGGG + Exonic
1143166333 17:4899069-4899091 CCTGGGCGCCGCCGCCCCCGAGG - Exonic
1143548563 17:7614719-7614741 CCCGTCCGCCGCCGCCGCCTTGG + Exonic
1144547997 17:16215477-16215499 TCCAGCCGCCGCCGCCGCCGCGG + Exonic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1146371121 17:32266099-32266121 CTGGAGCGGCGCGGCCGCCGCGG + Intergenic
1146398657 17:32487295-32487317 CCCGCCCGCCGCCGCCGCTGCGG - Intronic
1146716248 17:35089202-35089224 CCCCAGAGACGCCGCCGCGGCGG - Exonic
1147161768 17:38572767-38572789 CCCGGCCGCCTCCGCAGCCGCGG + Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148759696 17:49993361-49993383 CCCGCGCGCCCCCGCGGCCCTGG + Intronic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1149470838 17:56914022-56914044 CCCGCGCTCCGAGGCCGCCGAGG + Exonic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1150211925 17:63446421-63446443 CCCGAGCGTGGCCGCAACCGCGG - Intergenic
1150373505 17:64661883-64661905 CCCCGCCGCCCCCGCCGCCGGGG - Exonic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1151453406 17:74212743-74212765 CCCGAGCGCAGGCACCGCAGAGG - Intergenic
1151919146 17:77140868-77140890 CGCGTGCGCGGCCGCGGCCGAGG - Intronic
1152111583 17:78360076-78360098 CGCGAGCGCGGCCTCCGCGGCGG - Exonic
1152354147 17:79798467-79798489 CCCCAGCGCCGCCCCCGCCACGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1152758925 17:82098356-82098378 CCGGCGCGCCGCCGCCGGTGGGG + Intergenic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153480723 18:5543748-5543770 CCCGAGCCCCGCGCCCGGCGCGG - Intronic
1153997431 18:10454518-10454540 CCCCCGGGCAGCCGCCGCCGGGG - Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154255560 18:12778029-12778051 CCCGAGCCCGGCCGCCCCCACGG - Intergenic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1154954784 18:21242790-21242812 CCCCCTCGCCGCCTCCGCCGGGG - Intronic
1155928812 18:31685101-31685123 CCGGCGCCCCGCGGCCGCCGCGG + Intronic
1157609981 18:48950166-48950188 CGCGGGCGCCGGCGCGGCCGGGG - Exonic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158190959 18:54828425-54828447 ACCCAGCCCCGCCGCCGCGGCGG + Exonic
1158259087 18:55588061-55588083 TCCGTGCACCGCCGGCGCCGAGG + Intronic
1159798046 18:72867622-72867644 CCCGGGCATCGTCGCCGCCGCGG + Exonic
1160909364 19:1467717-1467739 CCCGAGCGCCCCCGCAGACAAGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160991818 19:1863275-1863297 CCCGGGCCCCGGCGCCGCCGCGG - Exonic
1160992207 19:1864415-1864437 CCCGGGCCCCGCCGCGGGCGCGG - Intergenic
1161011774 19:1962872-1962894 CCCGTGCGCAGACGCCGCCGTGG + Intronic
1161031897 19:2061447-2061469 CAGGCGCGCGGCCGCCGCCGGGG - Intergenic
1161241109 19:3224557-3224579 CCCGCGCGGCGCGGCCGCCAGGG + Intergenic
1161304065 19:3557359-3557381 CCGGAGCGGCGCCGTCCCCGCGG - Exonic
1161471271 19:4457725-4457747 CCCGTGCCCCCCCGCCCCCGCGG - Exonic
1161521112 19:4723889-4723911 CCCAAGCGCCGCGGACGCCTTGG - Intronic
1161532874 19:4800706-4800728 CCCGGGTGCCGCCGCCCCCATGG + Exonic
1161664560 19:5567647-5567669 CCCGAGCCCCGCGGCCACCTGGG + Intergenic
1162341853 19:10096144-10096166 CCCGAGCAGCGCCAGCGCCGCGG + Exonic
1162410684 19:10503258-10503280 CGCGGGCGCCTCCGCCGTCGGGG + Exonic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1162747416 19:12806531-12806553 CCCTGGCGCTCCCGCCGCCGTGG - Intronic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162770390 19:12945919-12945941 CCCGAGCGACGCGGCGGCCCCGG - Exonic
1162959466 19:14117544-14117566 CCCGGCCGCCGCCGCCGCGATGG - Exonic
1163138645 19:15331955-15331977 CCCGACCGCCGGCCCCGCCGCGG + Intronic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163453073 19:17390597-17390619 CCCGAGCGGGGACGCGGCCGGGG + Intergenic
1163548070 19:17950993-17951015 CCCGAGCCCCGCCCGCGCCACGG + Intergenic
1163606951 19:18280915-18280937 TTCGGGCGCGGCCGCCGCCGGGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163607223 19:18281886-18281908 CCCCGGCGCCGCCTCCGCCAAGG + Intergenic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165461110 19:35944931-35944953 CCTGAGCGCCGCGGGCTCCGGGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166723620 19:45012071-45012093 CCCCAGCCACGCCGCCGCCTTGG + Exonic
1167456233 19:49597780-49597802 CCCGATGGCCCCCGGCGCCGTGG + Exonic
1167501590 19:49851450-49851472 CCCGAGGCCCGCAGCCTCCGCGG + Exonic
1168073073 19:53963343-53963365 CCGAGGCGCCGCCGCCCCCGCGG - Exonic
1168336497 19:55600292-55600314 CCCCCGCCTCGCCGCCGCCGAGG + Intronic
1168612832 19:57814723-57814745 CCTTAGCGCGGCCGCCGCCATGG + Exonic
925959568 2:9003212-9003234 TCCGAGCGCCGCTGCCGCGAAGG + Intronic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
927606576 2:24491529-24491551 CCGGGGCGGCGCCGCCGCCACGG + Intergenic
927787130 2:25981941-25981963 CCCGAGCCCCTCCGCAGCCTGGG + Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
929218040 2:39436857-39436879 GCCGCGCGCCGCCGAGGCCGTGG - Intronic
929857893 2:45651401-45651423 CCCGATCGCCGGCTCCGGCGCGG + Intronic
929966847 2:46542851-46542873 CCGGGGCGCTGCCGCCGCCGCGG - Exonic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
930096464 2:47570348-47570370 CCCGAGCGCCGCCCCGGCCCCGG - Exonic
930700611 2:54456046-54456068 CCGGAGCCCCGCAGCCGCCCAGG - Intergenic
931253870 2:60554207-60554229 CCCGAGCGCAGCCGCGGGCTCGG - Intergenic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
932591525 2:73070800-73070822 CCCGGGCCCCCGCGCCGCCGGGG - Intronic
932599296 2:73112873-73112895 TCTGAGCGCCGCCGCAGCTGCGG + Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
932722403 2:74147744-74147766 CCCGACAGCCGCCGGCCCCGCGG + Intronic
932725682 2:74178377-74178399 CCCGAGCGCCCCCGAGGGCGGGG - Intronic
933090493 2:78110847-78110869 CCCGAGAGCCGCCGTAGCAGTGG + Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933911067 2:86942064-86942086 CTCGAGCGCCGACGTCGCCAAGG + Intronic
934011683 2:87825880-87825902 CTCGAGCGCCGACGTCGCCAAGG - Exonic
934021662 2:87961344-87961366 CTCGAGCGCCGACGTCGCCAAGG - Intergenic
934031860 2:88055592-88055614 CCGGGCCGCCCCCGCCGCCGGGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935059300 2:99593816-99593838 CCCCAGCGCGTCCGCGGCCGCGG + Exonic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936126631 2:109794249-109794271 CTGGAGCGCCGACGTCGCCGAGG + Intronic
936218062 2:110577219-110577241 CTGGAGCGCCGACGTCGCCGAGG - Intergenic
937203953 2:120223859-120223881 CAAGAGCGCCGCTGCCGCCTGGG - Intergenic
937283402 2:120735741-120735763 CCCGAACGCCGCCGGGGCGGGGG - Intronic
937917546 2:127106441-127106463 CCCGAGCGCCGGCCCAGCCTAGG + Intronic
938301115 2:130213667-130213689 CCGGGGCGCTGCCGCCGCGGCGG + Intergenic
938455602 2:131460800-131460822 CCGGGGCGCTGCCGCCTCCGCGG - Intergenic
938496935 2:131802637-131802659 CCCCAGCGCCGGCGCAGGCGCGG - Intergenic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942446190 2:176080404-176080426 CGCGCCGGCCGCCGCCGCCGAGG + Exonic
942454739 2:176130064-176130086 CCCGCGCGCCGCCGCCCTCCCGG - Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
944933619 2:204545486-204545508 CCAGAGCGCGGGCGCCGCAGAGG + Intergenic
945102506 2:206274954-206274976 GCCGCGCCCCGCCCCCGCCGCGG - Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948116008 2:235494587-235494609 CCGGGGCGCCGCAGCCCCCGGGG - Exonic
948216715 2:236237816-236237838 GCAGGGCGCCGCGGCCGCCGGGG + Exonic
948467432 2:238159061-238159083 CCTGCTGGCCGCCGCCGCCGCGG + Exonic
949004284 2:241636818-241636840 CCCCCGCGCCCCGGCCGCCGAGG + Intronic
1168753122 20:297747-297769 TCCGCGAGCCGCGGCCGCCGCGG + Exonic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1168965409 20:1895282-1895304 AGCGGCCGCCGCCGCCGCCGCGG - Intronic
1169093164 20:2873618-2873640 CGAGGCCGCCGCCGCCGCCGCGG + Intronic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169327550 20:4687257-4687279 CCCGGACCCCGCCCCCGCCGAGG - Intronic
1172064201 20:32207702-32207724 CCCGACCGCCGCCACTACCGGGG - Exonic
1173166079 20:40688242-40688264 GCCGCCCGCCGCCGTCGCCGAGG + Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1175429101 20:58890246-58890268 CCCCGAGGCCGCCGCCGCCGCGG + Intronic
1175429373 20:58891237-58891259 CCCAGCCGCCGCCGCCGCCGCGG + Intronic
1175847332 20:62065634-62065656 CCCGAGCGCGCCGGCGGCCGCGG + Exonic
1176207199 20:63895446-63895468 CCCGAGCGCCCGCGCAGCCCCGG - Intronic
1176213858 20:63939198-63939220 CCCGAGAGGAGTCGCCGCCGTGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176566768 21:8392115-8392137 TCCGAGCCCCGCCGGCGGCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177388050 21:20433035-20433057 CCCGTGAGCCCACGCCGCCGGGG + Intergenic
1179209428 21:39313181-39313203 CCCCAGTGTCCCCGCCGCCGGGG - Intronic
1179304541 21:40142326-40142348 CCCAAGTGCCGCCCCCGCCTAGG + Intronic
1179661524 21:42879086-42879108 CCCGGTCCCCGCCGGCGCCGCGG + Intronic
1179921700 21:44510871-44510893 CCCCGGCCCCGCCCCCGCCGAGG - Intronic
1180018174 21:45101079-45101101 CCCGGCAGCGGCCGCCGCCGCGG - Intronic
1180342441 22:11629097-11629119 CCCCACCGCCGCCGCCATCGCGG - Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180876868 22:19178740-19178762 ACCGGCCGCCGCCGCCACCGCGG - Exonic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181057760 22:20268030-20268052 CCCGAGCCCGGCCGGCGGCGGGG - Intronic
1181811266 22:25405107-25405129 CACGGGCGCCACCGCCGCCTTGG - Intronic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1183370146 22:37427521-37427543 CCCGGGCGCCCTCCCCGCCGAGG - Intergenic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1185255078 22:49827422-49827444 CCCGGCCGCCGCCGCCGCCTCGG - Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
950316391 3:12004935-12004957 GCCGGGCGCCGCCGCCCTCGGGG + Intronic
951217763 3:20040597-20040619 CCCCTGCGCCGCTGCCGCCGGGG + Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
961674404 3:128555844-128555866 GCCCAGCGCCGCAGCCGCTGCGG - Intergenic
962498634 3:135966499-135966521 CCTGGCCGCCGCCGCCGCGGAGG + Intronic
963673481 3:148280654-148280676 CCTGAGCCTCGCCCCCGCCGTGG - Intergenic
964786151 3:160399007-160399029 CCGGAGCCCCGCTGCCGCCAGGG + Intronic
965757419 3:172040317-172040339 CCCGACCGCCCCCGCCGGCGCGG - Intronic
965757540 3:172040638-172040660 CCCGAGGGGCGCCTCGGCCGGGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966849429 3:184155553-184155575 GCCGCGCGCCGCCGCCGTCTGGG + Exonic
968230785 3:197003435-197003457 CCCGGGCGCCGGGGCCGCTGGGG + Exonic
968541862 4:1172041-1172063 CCCCAGCCCGGCCGCCGCCCTGG - Exonic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968973465 4:3809079-3809101 CCCGGGTGCTGCCGCCTCCGAGG - Intergenic
969052986 4:4386151-4386173 CCCGAGCTCAGCCGCTGTCGCGG - Exonic
969113956 4:4859995-4860017 CCCCAGCGCCGCCGCGGCCACGG + Exonic
969394259 4:6910169-6910191 CCCGAGAGTCGCCCCCGCCCCGG - Intronic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
970967874 4:21948844-21948866 CCCGCGCGCCCCCGCCGCCAAGG - Intergenic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
971635141 4:29047799-29047821 CCCAGCCGCCGCCCCCGCCGTGG + Intergenic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973039907 4:45457205-45457227 CCCGAGCCTCCCTGCCGCCGTGG - Intergenic
975342569 4:73258561-73258583 GCCGACCTCCGCCGCCGCGGGGG + Exonic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
975986256 4:80203234-80203256 CGCGGCCGCCGCCGCAGCCGCGG - Exonic
977607440 4:98996274-98996296 CCCGAGCCCCGCCGGTGCTGCGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
980541439 4:134201523-134201545 TGCAGGCGCCGCCGCCGCCGAGG + Intronic
980913758 4:139015959-139015981 GCCGGGCGCCGCCGCCACCACGG - Exonic
981300937 4:143185181-143185203 CCCGTACTCCGCCGCCGCCCCGG - Exonic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745792 4:159103340-159103362 CCCCGGCGCCGGCGCCGCCGCGG - Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984778588 4:183504909-183504931 CCCCGGCGCCGGCCCCGCCGAGG + Intergenic
984908299 4:184649516-184649538 CCCTCGCGCCGCCTCCGCTGCGG + Intergenic
984917010 4:184734034-184734056 CGCGGCCGCCGCCGCCCCCGCGG + Exonic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
991676558 5:69094291-69094313 CAAGGCCGCCGCCGCCGCCGGGG - Exonic
992726554 5:79612812-79612834 CCCGTGCCCCGCCGCCGACCTGG - Exonic
992940038 5:81751838-81751860 CCCGGGCGCCGCCACCGCAGCGG - Intergenic
997965482 5:138352881-138352903 TCCGCTCGCCGCTGCCGCCGCGG - Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
998166656 5:139848230-139848252 CGCGAGCGGCGCCAGCGCCGGGG + Exonic
999300291 5:150486382-150486404 CCCGAGTGGCGCCCCAGCCGTGG + Intronic
1000302949 5:159972304-159972326 CCTGAGCCCCCCGGCCGCCGCGG + Exonic
1002895565 6:1378318-1378340 CCCGGCGGCCGCCGCTGCCGGGG + Intergenic
1003206574 6:4018495-4018517 CAAGAGCGCCGCCGCCGGCAGGG + Intergenic
1003212270 6:4078908-4078930 CCCGAGCGCCTCCGCGTGCGTGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004627975 6:17394092-17394114 CCCCAGCGCCGCCGCCCGCCCGG + Intronic
1004924527 6:20403850-20403872 CTCGGGGGCCGCCGACGCCGCGG + Intronic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1006794153 6:36721560-36721582 CCCGAGGGCCGCCTCCTCTGGGG + Exonic
1007406085 6:41637202-41637224 CGAGAGCGCTGCCGGCGCCGTGG + Intronic
1007630308 6:43269753-43269775 CCGAGGAGCCGCCGCCGCCGGGG - Intronic
1007784302 6:44271068-44271090 CCTGAGCCCCGCCCCCGGCGCGG - Intronic
1007902048 6:45422034-45422056 CTCCCGCGCCGCCGCCTCCGCGG - Intronic
1011603569 6:89081314-89081336 CCCGGGCCCGGCCGCCGCCTTGG + Exonic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1012530442 6:100229177-100229199 CCCGAGCGGCGGCGAGGCCGAGG - Intergenic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1013524111 6:110958768-110958790 CTCGTCCGCCGCCGCCGCCATGG - Exonic
1013836548 6:114342201-114342223 CGCCCGCGCCGCCACCGCCGGGG - Exonic
1016010786 6:139135615-139135637 CGCGAACGCTGCGGCCGCCGCGG + Exonic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017793636 6:157823069-157823091 CCCGCGCCGCGCCGCCGCCCCGG - Intronic
1018613055 6:165662158-165662180 CCCGGCCGCCGCCGCCGCCCCGG - Intronic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019153448 6:170023802-170023824 TCCGGGCGCCGCAGCCGCCTGGG + Intergenic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019473471 7:1233197-1233219 CTCGTGCGCCGCCGCCGCCTCGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019562632 7:1666079-1666101 CCCGAGCGCGGCGGCGGCGGCGG - Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020288817 7:6706743-6706765 CCCCAGCGCCGTCGGCTCCGGGG + Exonic
1021451304 7:20785544-20785566 CGCGGCCGCCGCAGCCGCCGAGG + Exonic
1022106253 7:27199829-27199851 CGCGGCCGCCGCCGCAGCCGCGG + Exonic
1023638416 7:42236479-42236501 CGCGGGGGCCGCCGCCGCTGGGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025301432 7:57821918-57821940 TCCAGACGCCGCCGCCGCCGCGG + Intergenic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1026727260 7:72879554-72879576 CCCCAGCGCCGCTGGCTCCGGGG - Exonic
1026817141 7:73521930-73521952 CCCCACCGCCGCCGCCGCGATGG - Exonic
1026968412 7:74454241-74454263 CCCGATCCCCTCCGCCTCCGGGG + Intronic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1028621458 7:92833444-92833466 CCCGAGCGCCTGAGCCGGCGGGG - Exonic
1028987743 7:97021367-97021389 CACGAGGCGCGCCGCCGCCGAGG - Intronic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030018113 7:105244721-105244743 CCCAGGCACAGCCGCCGCCGCGG + Intronic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031051868 7:116953412-116953434 CCGGAGCCCGCCCGCCGCCGGGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034455466 7:151167659-151167681 CCCGCGCCCCGCCGCCACCTCGG - Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034617834 7:152435212-152435234 CCCGAGCGCCGACGGCTCGGCGG + Intronic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1036453999 8:8892729-8892751 GCCGAGCTCGGCCACCGCCGGGG + Exonic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1037305150 8:17497031-17497053 CCCGCGCCCCGCCCCCGCCCCGG + Intergenic
1037819913 8:22130585-22130607 CTAGAGCGCCCCCGCCGCCCCGG - Exonic
1038304033 8:26383281-26383303 CCCGGCCGCCGCCACCGGCGCGG + Intronic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1039453828 8:37695594-37695616 GCCGCGCGCCGCCGCTGCCTCGG - Intergenic
1039873564 8:41567195-41567217 CCCGAGGGGCGCCGCGGCCTCGG + Intergenic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041753571 8:61288292-61288314 CCCGCTCCCCGCCGCCTCCGCGG + Intronic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042281573 8:67061982-67062004 CCCGGACGCCGCCATCGCCGAGG + Exonic
1043463990 8:80487056-80487078 GCCGGCCGCCGGCGCCGCCGAGG + Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047100163 8:121667533-121667555 CCCCCGCCCCGCCCCCGCCGGGG - Intergenic
1047732289 8:127737377-127737399 CCCGAGGGCGGCCGCGGCAGGGG - Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049660053 8:143815818-143815840 CCCGCGCGCCGCCGCCTCTGAGG + Intergenic
1049752222 8:144290732-144290754 ACCCAGCGCGGCCGCGGCCGAGG + Intronic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049784657 8:144444574-144444596 CGCGCCCGCCGCCGCCGTCGAGG - Intergenic
1049789540 8:144466484-144466506 CCCGGGCTCCGCGGCCGCCGCGG - Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1051809288 9:21031586-21031608 CCCATGGGCCGCCGCCGCCAGGG + Exonic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1052991820 9:34523029-34523051 AGCGAGCGCCGCGGCCGCGGAGG - Exonic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054333333 9:63781653-63781675 CCAGAGCGCCGGCGCAGGCGCGG + Intergenic
1054489418 9:65762591-65762613 CCCCCCCCCCGCCGCCGCCGCGG + Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055936835 9:81611801-81611823 GATGAGCGCCGCAGCCGCCGCGG - Exonic
1056985653 9:91361860-91361882 CCCAGGTGCCGCCGCCACCGCGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057618883 9:96618611-96618633 CCCGAACGCCTCCGCCTCCCGGG - Intronic
1057773343 9:97985061-97985083 CGCGAGCCCCCCCCCCGCCGCGG + Intronic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1057881524 9:98796294-98796316 CCCGACTGCCCCCGCCGCTGCGG + Exonic
1057921968 9:99105095-99105117 CCGGAGCGAGGCCGCCGCGGCGG + Exonic
1058058618 9:100473458-100473480 CCAGAGCCCCGCCGCTGCCTCGG - Exonic
1058546853 9:106069684-106069706 CCCCAGCACCGCCGCCACCACGG - Intergenic
1059123281 9:111661551-111661573 CCCGAGCGCGGGTGCCGCCCCGG - Exonic
1059375254 9:113876228-113876250 CCCCAGCGCCCCCGCCCCCCCGG + Intergenic
1059633914 9:116154283-116154305 CCCGCGCCCCGCCGCCGGCCCGG + Exonic
1060208954 9:121699007-121699029 CCCGAGCCCCCCGGGCGCCGGGG - Intronic
1060700635 9:125747009-125747031 CTCGGCCGCCGCCGCCGCCTCGG - Intergenic
1060855956 9:126915099-126915121 CCCGAGGGCCGCCGAAGCCGGGG + Intronic
1061144057 9:128787046-128787068 CCCCAGCGCCGCCGACCCTGCGG - Intergenic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062346726 9:136118497-136118519 CCGGGACGCCGGCGCCGCCGCGG - Exonic
1062414224 9:136439699-136439721 CCCGAGCGGCGTCCCCGTCGGGG - Exonic
1062490765 9:136803845-136803867 CCCCAGCCCAGCCGCCTCCGTGG - Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1062594997 9:137295551-137295573 CCCGAGCCTCGGAGCCGCCGCGG - Intergenic
1062629972 9:137459145-137459167 CGCGCCCGCCGCCTCCGCCGGGG + Exonic
1062630771 9:137462141-137462163 TCCGCCCGCCTCCGCCGCCGCGG + Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1202779999 9_KI270717v1_random:24912-24934 CCCGCCACCCGCCGCCGCCGCGG - Intergenic
1203731877 Un_GL000216v2:98808-98830 CCCGACCCCTTCCGCCGCCGGGG + Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1186768103 X:12791627-12791649 CCCTAGCCCGGCCGCCGGCGCGG - Intronic
1187900943 X:24025861-24025883 CCCCCGCGGCGCCGCCGTCGGGG + Intronic
1187915547 X:24149801-24149823 CCCGGGTGCCGCCGCGGCCGCGG + Intronic
1189354229 X:40299095-40299117 CCCGCGCCCCGCCCCCGCCCGGG - Intergenic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1196684089 X:118495953-118495975 CCCGCCCGCCGCCGCTGCCATGG + Exonic
1198388137 X:136147716-136147738 CCCGAGCGGCGGCGGCGGCGGGG - Intronic
1198451027 X:136767314-136767336 CCTGAGCGCGGCCGCCACCAGGG + Intronic
1198767086 X:140091321-140091343 CTCGGTCGCCGCCGCCGCTGCGG - Intergenic
1200100949 X:153688890-153688912 CCCGACCCCCGGAGCCGCCGCGG + Intronic
1200306068 X:155027083-155027105 CGCGCGCGCGGCCGGCGCCGCGG + Intronic
1200418257 Y:2935453-2935475 CCCGCGTGCCCCCGCGGCCGCGG + Intronic
1201077154 Y:10196806-10196828 CCCCATCGCCGCCGCCGTCACGG - Intergenic