ID: 1096773994

View in Genome Browser
Species Human (GRCh38)
Location 12:53953176-53953198
Sequence GCAGTTCGAAGCTCGCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096773994_1096774000 0 Left 1096773994 12:53953176-53953198 CCGAGCTGCGAGCTTCGAACTGC 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1096774000 12:53953199-53953221 TCCGGGCAGGGCGGCGCCCGCGG 0: 1
1: 1
2: 0
3: 20
4: 250
1096773994_1096774006 17 Left 1096773994 12:53953176-53953198 CCGAGCTGCGAGCTTCGAACTGC 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1096774006 12:53953216-53953238 CCGCGGGGACACATTTCTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1096773994_1096773999 -9 Left 1096773994 12:53953176-53953198 CCGAGCTGCGAGCTTCGAACTGC 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1096773999 12:53953190-53953212 TCGAACTGCTCCGGGCAGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
1096773994_1096774003 2 Left 1096773994 12:53953176-53953198 CCGAGCTGCGAGCTTCGAACTGC 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1096774003 12:53953201-53953223 CGGGCAGGGCGGCGCCCGCGGGG 0: 1
1: 0
2: 3
3: 33
4: 455
1096773994_1096774002 1 Left 1096773994 12:53953176-53953198 CCGAGCTGCGAGCTTCGAACTGC 0: 1
1: 0
2: 1
3: 1
4: 40
Right 1096774002 12:53953200-53953222 CCGGGCAGGGCGGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 36
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096773994 Original CRISPR GCAGTTCGAAGCTCGCAGCT CGG (reversed) Intergenic