ID: 1096774389

View in Genome Browser
Species Human (GRCh38)
Location 12:53955314-53955336
Sequence CCGAGCGCAGGCGGCCCCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096774389_1096774403 28 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774403 12:53955365-53955387 GGCGGTGGCGACGGCGGCGGCGG 0: 1
1: 70
2: 1242
3: 1985
4: 4001
1096774389_1096774401 22 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774401 12:53955359-53955381 GGCGGCGGCGGTGGCGACGGCGG 0: 1
1: 47
2: 1200
3: 1945
4: 3898
1096774389_1096774393 -3 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774393 12:53955334-53955356 CGGCTTCAAGTACGACTACGCGG 0: 1
1: 0
2: 0
3: 3
4: 12
1096774389_1096774395 1 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774395 12:53955338-53955360 TTCAAGTACGACTACGCGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 10
1096774389_1096774400 19 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774400 12:53955356-53955378 GCGGGCGGCGGCGGTGGCGACGG 0: 1
1: 3
2: 59
3: 447
4: 2937
1096774389_1096774394 0 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774394 12:53955337-53955359 CTTCAAGTACGACTACGCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1096774389_1096774399 13 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG 0: 1
1: 1
2: 13
3: 113
4: 598
1096774389_1096774397 7 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774397 12:53955344-53955366 TACGACTACGCGGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
1096774389_1096774398 10 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774398 12:53955347-53955369 GACTACGCGGCGGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 22
4: 186
1096774389_1096774402 25 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774402 12:53955362-53955384 GGCGGCGGTGGCGACGGCGGCGG 0: 1
1: 47
2: 1197
3: 1913
4: 3984
1096774389_1096774396 4 Left 1096774389 12:53955314-53955336 CCGTCGGGGCCGCCTGCGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1096774396 12:53955341-53955363 AAGTACGACTACGCGGCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 5

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096774389 Original CRISPR CCGAGCGCAGGCGGCCCCGA CGG (reversed) Exonic
901007910 1:6180504-6180526 CCGCGCGCCCGCGGACCCGACGG + Intergenic
902509934 1:16961018-16961040 CCGAGCGCAGGCCACCCAGCTGG - Exonic
903772505 1:25772760-25772782 CCCAGGGAAGGCGGACCCGATGG - Intronic
907850416 1:58250052-58250074 CCGAGCTCTCGCGGCCGCGAGGG - Intronic
922821301 1:228487508-228487530 CAGGGCGCAGGCGGCCTCGGCGG - Exonic
1071600704 10:86957496-86957518 CCCAGCCCAGGGGGCCCCCAAGG + Exonic
1071630235 10:87213881-87213903 CCGAGCCCAGGCAGCCCTGCAGG + Intergenic
1073326072 10:102644501-102644523 CCGGCCCCAGCCGGCCCCGACGG - Exonic
1075587158 10:123666312-123666334 CCGGGCGGCGGCGGCGCCGAGGG + Intergenic
1077316041 11:1919799-1919821 CCGCACGCAGGAGGCCCCGTCGG - Intronic
1080283595 11:30585377-30585399 GCGCGCGCGGGCGGCCCCGGGGG + Intronic
1081804494 11:45883055-45883077 CCCAGCTCAGGTGGCCCTGAGGG + Exonic
1087242024 11:95790513-95790535 GTGAGCGTAGGCGGCCCTGAGGG + Exonic
1094536207 12:31324617-31324639 CCGAGCGCCGGGGGCCCGCACGG + Intronic
1096774389 12:53955314-53955336 CCGAGCGCAGGCGGCCCCGACGG - Exonic
1097712966 12:62935043-62935065 CCGAGCGCAGGGGGCGGGGAAGG - Intergenic
1102371078 12:112382532-112382554 CCGAGGGCAGGCGGCAGCGAAGG - Intergenic
1105378300 13:19864018-19864040 GCGAGGGCAGGCAGCCCCGCCGG - Intergenic
1105388921 13:19958330-19958352 GCGAGGGCAGGCGGCCCCGCCGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106157494 13:27171784-27171806 CTGAGCGCCGGCGGCGACGACGG - Exonic
1112693055 13:101917174-101917196 CCGAGAGCGGGCGGCGCCGGCGG - Intronic
1115203024 14:30874281-30874303 TGGAGGGCCGGCGGCCCCGACGG - Intergenic
1119046288 14:71321001-71321023 CGGAGCGGAGGGGGGCCCGAGGG - Intronic
1121957630 14:98228524-98228546 CCCAGGGCAGGCGGACCCGCTGG + Intergenic
1122631688 14:103110151-103110173 CGAAGAGCACGCGGCCCCGAGGG - Exonic
1122666742 14:103334916-103334938 CCGAGAGCCGGCGGCCCCGGAGG - Intronic
1122750213 14:103927847-103927869 GGGAGGGCAGGCGGCCCTGATGG - Intronic
1128322526 15:66703381-66703403 CCGAGCTGAGCCGGCCCCGCGGG + Exonic
1129348223 15:74937939-74937961 CGGAGTGCAGGAGGCCTCGAGGG + Exonic
1129729031 15:77919061-77919083 CCGAGAGCAGGAGGCGCAGAGGG - Intergenic
1129791186 15:78341528-78341550 CCAAGCGCAGGCGGCGCAGGAGG + Intronic
1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG + Intronic
1136666732 16:31819392-31819414 CAGCGCGCTGGGGGCCCCGAGGG + Intergenic
1142253035 16:89001510-89001532 CCGAGCACAGGAGGCTCCCAGGG - Intergenic
1142697927 17:1643817-1643839 CCGTGCGCCTGCGGCCCCCACGG - Exonic
1144816723 17:18040004-18040026 CCGGGTGCAGGAGGCCCCGGCGG - Intronic
1146594465 17:34157029-34157051 CCGAGCGGCGGCGGCTCTGAAGG - Intronic
1147671741 17:42180579-42180601 CCGAGAGTGGGCGGCTCCGAAGG + Intronic
1148456087 17:47812281-47812303 AGGAGCGCTGGGGGCCCCGAAGG - Intronic
1148646927 17:49224583-49224605 CCCCGCGCATCCGGCCCCGACGG + Exonic
1151453404 17:74212742-74212764 CCGAGCGCAGGCACCGCAGAGGG - Intergenic
1152284085 17:79402529-79402551 GTGAGCGCAGGGGGCCCCGCGGG + Intronic
1152468060 17:80476742-80476764 GCGAGCGGAGGCAGCCCCGGTGG - Intronic
1152575315 17:81137438-81137460 CCGAGAGCAGGTGGGCCTGAGGG - Intronic
1152608897 17:81306129-81306151 CCCTGCCCAGGCGGCCCCCAGGG - Intergenic
1160613847 18:80109370-80109392 GCGGGCGCAGGCGGCCCCACGGG + Exonic
1161069388 19:2252750-2252772 CGGGGCGCAGGCGGCGCTGATGG + Exonic
1161234578 19:3191516-3191538 CCTAGAGCAGGCGAGCCCGAGGG + Intronic
1161703087 19:5805357-5805379 GCGGGCCCAGGCGGCCCGGATGG + Intergenic
1161737902 19:6002792-6002814 CCTGGCGCAGGCGGCCCGGGCGG - Exonic
1162952791 19:14081856-14081878 CCGAGCGCAGCCGGGCCTGCGGG - Exonic
1163442644 19:17329421-17329443 CCGCGAGCAGGAGGCCCCGGAGG + Intronic
1167444539 19:49529445-49529467 CTGAGCGCAGGGGGGCGCGATGG + Intronic
926958396 2:18327681-18327703 CAGAAAGCAGGCGGCCCTGAGGG - Intronic
941110413 2:161414777-161414799 CCGAGAGCTGGCCGGCCCGAGGG - Intergenic
1170581176 20:17700742-17700764 CCGAGTGCAGGTGGCCCATATGG - Intronic
1171035414 20:21709333-21709355 CCTTGCGCAGGCGGCCACGGCGG - Exonic
1172173664 20:32959817-32959839 GCGAGAGCAGGCGGCGCTGATGG + Intronic
1175998325 20:62821193-62821215 CCCAGCCCGGGCGGCCCCGGGGG - Exonic
1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG + Intronic
1176246216 20:64098412-64098434 CCGAGAGCAGGCGGACTCCACGG - Exonic
1179605706 21:42513984-42514006 CTGAGCGCCGGCTGCCCCGCAGG - Exonic
1180985095 22:19899380-19899402 CCTAGCCCAGGAGGCCCCGGGGG - Intronic
1184766960 22:46577156-46577178 CCGGGAGGAGGCGGCCCCGCGGG - Intronic
1185282827 22:49983039-49983061 CCGAGGGCAGGCTGCCCAGCGGG - Intergenic
950550631 3:13663963-13663985 TCGGCCGCAGGCTGCCCCGATGG + Intergenic
953020070 3:39107495-39107517 CAGCCCGCAGGCGGCGCCGAGGG - Exonic
958898193 3:99853920-99853942 CTGAGAGCAGGAGGCCCTGATGG + Intronic
968685925 4:1958542-1958564 CTGAGCGCAGGCAGCCCTGAGGG - Intronic
969517736 4:7656927-7656949 CCGGGGGCAGGCGGCCCTCAGGG - Intronic
969711605 4:8847528-8847550 CCGAGAGCAGGCGGACCTGAAGG + Intronic
981044471 4:140252869-140252891 CCGAGCGCAGGCCCGCCCGACGG - Intergenic
1002160194 5:177310471-177310493 CCGGGCACAGTCGGCCCCCAGGG + Exonic
1016386817 6:143537245-143537267 CCGCGGGCAGGTGGCCGCGAGGG + Intronic
1018842866 6:167531172-167531194 CAGAGCACCTGCGGCCCCGATGG - Intergenic
1019383712 7:741562-741584 CTGAGCCCAGGCGGCCGCGTCGG + Intronic
1021828185 7:24574222-24574244 CCGAGCACAGGCTGCCGCGGGGG + Intronic
1025089696 7:56051890-56051912 CCGAGCGCAGGCGGCGCTGGCGG + Exonic
1027219625 7:76205622-76205644 CAGAGCCCAGGAGGCCCCCAAGG - Intronic
1033223613 7:139544415-139544437 CAGAGGGCAGGCGGCTCCGCTGG - Exonic
1037116849 8:15237423-15237445 CCGGGCGCAGGCGCCCCTGCTGG - Intronic
1041696470 8:60741952-60741974 CCCTGTGCAGGGGGCCCCGACGG - Exonic
1052805279 9:33007864-33007886 CTGAGCCCAGGCTGCCCAGAGGG + Intronic
1053001177 9:34578035-34578057 CGGAGCGCCGGAGGCACCGACGG - Intronic
1060700619 9:125746975-125746997 CCGAGCCCCGGCGGCCCCGGGGG - Intergenic
1061272299 9:129550285-129550307 CTGGGCGCAGCCGGCCCGGAGGG - Intergenic
1062406753 9:136400315-136400337 GCGCGCGGAGGCGGCCCCCAGGG - Intergenic
1062583991 9:137240842-137240864 CCGAGGGAGGGCGGGCCCGACGG - Intergenic
1187225848 X:17375146-17375168 CCGGGCGCAGGAGGCCGCGCGGG - Intergenic
1188451065 X:30308679-30308701 TCAAGCGCAGGCGGCTCCGGAGG - Exonic
1191184204 X:57592454-57592476 CCTAGCGCAGTGGGCCCCGCGGG - Exonic
1195727784 X:107935714-107935736 CAGAGAGGAGGCGGCCCAGAGGG - Intergenic
1198312693 X:135436931-135436953 CCGAGCGCAGGCCGCCCAGCTGG - Intergenic
1201010999 Y:9548100-9548122 CCCGGCGCATGCGGCCCTGAGGG + Intergenic