ID: 1096774421

View in Genome Browser
Species Human (GRCh38)
Location 12:53955449-53955471
Sequence CTGCTCAACGAGGGCAACAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096774411_1096774421 15 Left 1096774411 12:53955411-53955433 CCTCCTGCCAGTCGCTGGAATCC 0: 1
1: 0
2: 1
3: 18
4: 188
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774412_1096774421 12 Left 1096774412 12:53955414-53955436 CCTGCCAGTCGCTGGAATCCGAC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774414_1096774421 -6 Left 1096774414 12:53955432-53955454 CCGACTCCAGTTCGTCCCTGCTC 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774410_1096774421 16 Left 1096774410 12:53955410-53955432 CCCTCCTGCCAGTCGCTGGAATC 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774406_1096774421 28 Left 1096774406 12:53955398-53955420 CCGCACGACCCGCCCTCCTGCCA 0: 1
1: 0
2: 0
3: 22
4: 341
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774407_1096774421 20 Left 1096774407 12:53955406-53955428 CCCGCCCTCCTGCCAGTCGCTGG 0: 1
1: 1
2: 2
3: 33
4: 348
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774409_1096774421 19 Left 1096774409 12:53955407-53955429 CCGCCCTCCTGCCAGTCGCTGGA 0: 1
1: 0
2: 0
3: 36
4: 308
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1096774413_1096774421 8 Left 1096774413 12:53955418-53955440 CCAGTCGCTGGAATCCGACTCCA 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096774421 Original CRISPR CTGCTCAACGAGGGCAACAA GGG Exonic
900125387 1:1066892-1066914 CTGCTCAACGAGGATGACAGCGG + Intergenic
901573338 1:10179778-10179800 CGGCTCAATGAGGGAAAGAATGG + Intronic
906554378 1:46696412-46696434 CTGCTCCAAGAGGGCAGTAATGG - Intronic
908299175 1:62745094-62745116 CTGATCAATGAGGGATACAAAGG + Intergenic
910067792 1:83174403-83174425 GTGATCAATGAGGACAACAATGG + Intergenic
917022441 1:170603589-170603611 ATGCTCAGCCAGGGCAAAAATGG - Intergenic
919644099 1:200075635-200075657 CTGCTCAACTTGTGCTACAACGG - Intronic
920347962 1:205318807-205318829 CTGCTCTAGGAGGACATCAAAGG - Intronic
920585566 1:207156461-207156483 CTGCTCAACATGGTCAACTAGGG - Intergenic
1063320196 10:5045320-5045342 CTCCTCAGCCAGTGCAACAAGGG - Intronic
1067062160 10:43083092-43083114 CTCCTCACCCAGGGAAACAACGG + Intronic
1076686587 10:132200921-132200943 CTGATCCCCGAGGGCACCAACGG + Exonic
1089290207 11:117433152-117433174 CTGCTCATCGAGGACAAAGAAGG - Exonic
1091281067 11:134381966-134381988 CTGGTGAATGAGGGCAAGAAGGG - Exonic
1092148192 12:6229198-6229220 CTGCTGAATGAGGGCATCTAGGG + Intronic
1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG + Exonic
1100643395 12:96504484-96504506 CTGCTCAACCAGTGAATCAATGG - Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1122546772 14:102527437-102527459 CTGCACAACTAGGGAAACAATGG + Intergenic
1123630868 15:22258713-22258735 CAGCTCAACGAGGGCCGCACGGG + Intergenic
1127275291 15:57438360-57438382 CTGCTCCATGAGGGCAAGAATGG + Exonic
1127536882 15:59898452-59898474 TTGCTCAACAAGGATAACAATGG + Intergenic
1128151416 15:65365630-65365652 AGGTTCAAAGAGGGCAACAAAGG - Intronic
1129412338 15:75356829-75356851 CTGCTCAACGACTGCAAGTATGG - Exonic
1132945517 16:2529777-2529799 CTTCTCCAGGAGGGCAACCAAGG - Intronic
1141272416 16:82553441-82553463 CTGCTAAGGGAGGGCAAGAAGGG + Intergenic
1142675260 17:1509343-1509365 CTGTTCTACCAGGGGAACAAAGG - Exonic
1159761628 18:72433845-72433867 GTTGTCAACGAGGGCGACAAGGG - Intergenic
1161533540 19:4804511-4804533 CTGCTCAACGAGGGAATGAACGG + Intergenic
931659398 2:64544583-64544605 CTGCTCAACAGGGGAAAAAAAGG - Intronic
936292679 2:111238587-111238609 CTGCTCAAGAAGGGCAGGAAGGG + Intergenic
942414444 2:175744127-175744149 ATGCTAAACGAGGGGAACACGGG - Intergenic
942415101 2:175750412-175750434 TTGCTCAACGAGAGTAACAAAGG + Intergenic
943792670 2:191952047-191952069 CTGAGCAACAAGGGCAGCAATGG - Intronic
944666220 2:201961657-201961679 CTGCTGCACGAGGCCTACAAAGG + Intergenic
948355516 2:237374242-237374264 CTGCCCATCGAGGCCAAAAAGGG + Intronic
1169035396 20:2446993-2447015 ATGAGCAACGAGGGCAACTAAGG - Intergenic
1175511024 20:59526211-59526233 CTTCTCACAGAGGGCAACAAAGG - Intergenic
953159230 3:40403064-40403086 CAGCTCACGGAGGGAAACAAAGG - Intronic
953297253 3:41732153-41732175 CTGCACAACAAAGGAAACAAGGG + Intronic
954095502 3:48323484-48323506 CTTCTTAACGATGGCACCAAAGG - Intronic
961924339 3:130461376-130461398 CTGCTTATTGAGGGCAACCATGG + Intronic
967464331 3:189785877-189785899 ATGCTGAATGAGGGCAAAAAAGG - Intronic
968613359 4:1566936-1566958 CTGCTCCAGGAGGGTCACAAGGG - Intergenic
969597301 4:8156741-8156763 ATCATCAACAAGGGCAACAAGGG - Intronic
981689102 4:147486667-147486689 CTGCTCAGCAAGGTCAACAGTGG - Intronic
982639389 4:157938195-157938217 CTGCTCAAGGAAGTCATCAAAGG + Intergenic
987233028 5:15914776-15914798 CTGCTCAACTAATGCACCAAGGG - Intronic
990682336 5:58259196-58259218 CTCCTCAATGGGGGCACCAAAGG + Intergenic
993232890 5:85261234-85261256 CTGCACAAACAAGGCAACAAAGG + Intergenic
993559623 5:89389470-89389492 CTGCTCAATGAGGAGAACAGAGG + Intergenic
993560593 5:89402582-89402604 CTGCAGAACAGGGGCAACAAAGG + Intergenic
1003155909 6:3594135-3594157 CTGTTCAGCGAGTGCAACAAAGG - Intergenic
1004956454 6:20732977-20732999 CTGCTTTACAAGGGCAACAAGGG - Intronic
1014789596 6:125657487-125657509 CTGCTCAGAGTAGGCAACAAAGG + Intergenic
1027276304 7:76560358-76560380 GTGATCAATGAGGACAACAATGG - Intergenic
1028130528 7:87167002-87167024 CTTCTCAATGAGGGCAAATATGG - Intronic
1031904708 7:127447483-127447505 CTGCTCATCCCGGGCAACAGAGG + Intergenic
1034080320 7:148271196-148271218 CTATACAACGAGGGTAACAATGG - Intronic
1039617260 8:38966134-38966156 CTGGTGCACGAGGGCAAAAAGGG - Intronic
1046082484 8:109388256-109388278 CAGCTCCCCAAGGGCAACAAAGG + Intronic
1056453859 9:86741744-86741766 CTGCTCAGAGAGGGACACAAGGG + Intergenic
1057129274 9:92641935-92641957 CTGATCAAAAAGGACAACAAAGG + Intronic
1059951641 9:119469758-119469780 CTGCACAACAAAGGAAACAATGG - Intergenic
1060162442 9:121377438-121377460 CTGCTCAAAGAGCTTAACAATGG + Intergenic
1061800685 9:133112058-133112080 CTGCACCACGGAGGCAACAAGGG - Exonic
1190708332 X:53048675-53048697 ATGCAAAACGAGGGCACCAAGGG - Intergenic