ID: 1096776140

View in Genome Browser
Species Human (GRCh38)
Location 12:53965505-53965527
Sequence GGGGCTGTGAAGGCCAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096776120_1096776140 21 Left 1096776120 12:53965461-53965483 CCCCCTCTCCCCCAGGAACACCT No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776124_1096776140 18 Left 1096776124 12:53965464-53965486 CCTCTCCCCCAGGAACACCTGGG No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776122_1096776140 19 Left 1096776122 12:53965463-53965485 CCCTCTCCCCCAGGAACACCTGG No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776128_1096776140 13 Left 1096776128 12:53965469-53965491 CCCCCAGGAACACCTGGGTGGGG No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776134_1096776140 1 Left 1096776134 12:53965481-53965503 CCTGGGTGGGGCAAAAGCCAGGC No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776130_1096776140 12 Left 1096776130 12:53965470-53965492 CCCCAGGAACACCTGGGTGGGGC No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776132_1096776140 10 Left 1096776132 12:53965472-53965494 CCAGGAACACCTGGGTGGGGCAA No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776121_1096776140 20 Left 1096776121 12:53965462-53965484 CCCCTCTCCCCCAGGAACACCTG No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776131_1096776140 11 Left 1096776131 12:53965471-53965493 CCCAGGAACACCTGGGTGGGGCA No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data
1096776119_1096776140 25 Left 1096776119 12:53965457-53965479 CCTTCCCCCTCTCCCCCAGGAAC No data
Right 1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096776140 Original CRISPR GGGGCTGTGAAGGCCAGTTC AGG Intergenic
No off target data available for this crispr