ID: 1096777411

View in Genome Browser
Species Human (GRCh38)
Location 12:53972803-53972825
Sequence CAGGATTGGGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1759
Summary {0: 1, 1: 0, 2: 13, 3: 139, 4: 1606}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096777411 Original CRISPR CAGGATTGGGGGAAGGAGGA GGG (reversed) Intergenic
900190223 1:1349969-1349991 CAGGATGGGAGGAGTGAGGAGGG + Intergenic
900295817 1:1948965-1948987 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
900335353 1:2160468-2160490 CAGGCCTGTGGGAAGGACGAGGG + Intronic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
900932796 1:5747514-5747536 CAGGAAGGGAGGAAGGAGGGGGG + Intergenic
901029939 1:6301148-6301170 TAGCTGTGGGGGAAGGAGGAGGG + Intronic
901040313 1:6359462-6359484 AGGGGTTGGGGGAAGGAAGAGGG - Intronic
901186110 1:7374458-7374480 CAGGCATGGGGAGAGGAGGAGGG + Intronic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901529641 1:9844817-9844839 CAGGTTTTGGGGAAGGCGGAGGG + Intergenic
901672820 1:10866304-10866326 CAGGTTGGGGGGCAGGTGGAGGG - Intergenic
901683016 1:10926476-10926498 CAGGATTGGTGGAGGCAGCAAGG - Intergenic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
901915434 1:12495900-12495922 CGGGGTTGGGGGAAGGAGCTTGG - Intronic
901938620 1:12645132-12645154 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
902450670 1:16494877-16494899 AAGGGTTGGGGGAAGGAGACAGG + Intergenic
902460385 1:16570999-16571021 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902676388 1:18011405-18011427 CAGGGTGGGGGGATGGGGGAGGG + Intergenic
902709687 1:18230293-18230315 CAAGAGTGGGGGAGAGAGGAGGG - Intronic
902848838 1:19136900-19136922 TAGGATTCGGGGAACGTGGAAGG + Intronic
902885361 1:19400883-19400905 CAGGATCGGGGCAAGGTGGTAGG - Intronic
903180161 1:21601353-21601375 CAGGGTTGGGGGGATGAAGAGGG - Intronic
903224488 1:21887085-21887107 CAGGCTTGGGGGACTGGGGAGGG + Intronic
903232021 1:21927700-21927722 CTGGACTGGGAGAAGGAGGGGGG - Intronic
903557380 1:24203475-24203497 CAGGAGGGAGGGAAGGAGGGAGG - Intergenic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903736722 1:25534561-25534583 CAGGCATGGGGGAGGGGGGATGG - Intergenic
903738623 1:25545213-25545235 CAGGAATGAGGGAGGGAGGGTGG + Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904087158 1:27917029-27917051 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
904446940 1:30581426-30581448 CAGGGTCGGGGGCTGGAGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904836124 1:33338098-33338120 CAGGAGTGGGGGATGGAGGCAGG - Intronic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905191198 1:36236452-36236474 AAGGAAAGGGGGAAGAAGGAAGG - Intronic
905201325 1:36319178-36319200 TGGGGTTGGGGGAAGGAGGAGGG + Intronic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905654692 1:39678594-39678616 CAGGATTGGGGTGGGGAGAAAGG - Intergenic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
905691044 1:39943036-39943058 AAGGTATGGGGGAAGGAGCATGG + Intergenic
905933812 1:41807878-41807900 CATGATGGGGGGCAGGGGGAAGG + Intronic
906145359 1:43557310-43557332 CAGGCCTGGGGTGAGGAGGACGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906199918 1:43953361-43953383 TAGGTTTGGGGGAAGGAGACAGG - Intronic
906318394 1:44802463-44802485 CAGGAGTGCAGGAAGGGGGAAGG + Intronic
906448229 1:45922123-45922145 CAGGCTTGGGGAGAGGAGGGAGG - Intronic
906545065 1:46614724-46614746 CAGGATTGGGGAAGGGAGGGTGG + Intronic
906674950 1:47686925-47686947 CAGGACTGGGACTAGGAGGATGG - Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907220915 1:52906487-52906509 CAGGACTGGGGGCAGGGGGTGGG - Intronic
907400903 1:54224142-54224164 CAGGGCTGGGGAAAGGAGGTTGG - Intronic
907514005 1:54981703-54981725 CAGGAGTGGGTGCAGGAGGGAGG + Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907795382 1:57710915-57710937 CAAGATTGGGGCAGGCAGGAGGG + Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
907869885 1:58433270-58433292 CAGAAGTGTGGGAAAGAGGAAGG + Intronic
907951622 1:59189030-59189052 TAGGAGTGGGGGATGGAGGAGGG + Intergenic
908630745 1:66104079-66104101 GAGGGTGGGGGGAGGGAGGAGGG - Intronic
908748951 1:67401334-67401356 AAGGAATGGGGGAAGGGGCATGG - Intergenic
909001384 1:70221538-70221560 CCGGATTGCGGGAGAGAGGAGGG - Intronic
909037452 1:70610187-70610209 TGGGATTGGGGGAGGGGGGAGGG - Intergenic
909162196 1:72166753-72166775 CAGGATCTGGGGAAGACGGATGG + Intronic
909296387 1:73954381-73954403 AAGGAAGGGAGGAAGGAGGAAGG - Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909596696 1:77413818-77413840 CAGGGTTGGGGCAGGGAGGAGGG - Intronic
909688539 1:78378351-78378373 GAGGATTTGGGGGAAGAGGAGGG + Intronic
909767284 1:79372153-79372175 AAGGATGGAGGGAGGGAGGAAGG - Intergenic
909919081 1:81357707-81357729 CAGGCTTGGGGGTAGAAGGTAGG + Intronic
910008264 1:82427296-82427318 CATAAATGGAGGAAGGAGGAAGG - Intergenic
910091045 1:83464659-83464681 TAGGATTGGGGCAAGAAAGAAGG + Intergenic
910424303 1:87103429-87103451 CAGGAATGTGGGAAGCAGGTGGG + Exonic
910671330 1:89775810-89775832 AGGGGTTGGGGGTAGGAGGATGG - Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
910897930 1:92087303-92087325 TGGGATGGGGGGAAGGAGGGTGG + Intronic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912037061 1:105331043-105331065 CAGGAGTGGGGGAAGGCACAAGG + Intergenic
912101615 1:106213726-106213748 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
912170802 1:107097180-107097202 GAGGGTTGGGGGAGGGAGCAGGG - Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
913137633 1:115908264-115908286 CAGCCTTGGGATAAGGAGGATGG - Intergenic
913261387 1:117000997-117001019 TAGGGTCGGGGGAAGGGGGAGGG + Intergenic
913359497 1:117964087-117964109 CAGGCTTGGGGGTTAGAGGATGG + Exonic
913370355 1:118092314-118092336 AAGGATTGGGAGAGGGAGAATGG - Intronic
913490452 1:119374872-119374894 CCTGACTGAGGGAAGGAGGAAGG - Intronic
913544831 1:119858048-119858070 GAGGATTGGGGAATGGATGATGG - Intergenic
913605029 1:120457580-120457602 TAGGGTGGGGGGAGGGAGGAGGG + Intergenic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
913958952 1:143324552-143324574 CGGCATTGGGGGACGGAGGTGGG - Intergenic
914053269 1:144149932-144149954 CGGCATTGGGGGACGGAGGTGGG - Intergenic
914083510 1:144431633-144431655 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914125928 1:144816609-144816631 CGGCATTGGGGGACGGAGGTGGG + Intergenic
914189532 1:145396909-145396931 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914211380 1:145582616-145582638 TAGGGTGGGGGGAGGGAGGAGGG - Intergenic
914366231 1:146981130-146981152 TAGGGTGGGGGGAGGGAGGAGGG + Intronic
914486212 1:148112294-148112316 TAGGGTGGGGGGAGGGAGGAGGG - Intronic
914628297 1:149484347-149484369 TAGGGTGGGGGGAGGGAGGAGGG + Intergenic
914786989 1:150842518-150842540 AAGGAAGGGGGGAGGGAGGAAGG + Intronic
914919288 1:151836972-151836994 CAGGCTTGGAGGAGGGAGGGAGG - Intergenic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
914998660 1:152566592-152566614 CAGCAATGGGGGAAGGGGGCAGG - Intronic
915280109 1:154816647-154816669 CAGGAGTGAGGAAGGGAGGATGG - Intronic
915468694 1:156113365-156113387 CAGGATAGGGGCCAGGATGAGGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915725123 1:158011770-158011792 CAGCAGTGGGGGAAGGAGCCTGG + Intronic
915981679 1:160424308-160424330 GAGGAGCTGGGGAAGGAGGAAGG - Intronic
916452096 1:164930527-164930549 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916822926 1:168417240-168417262 AAGGATTTGAGGATGGAGGAAGG + Intergenic
916964165 1:169918110-169918132 CAGGAGGGAGGGAAGGAGAAAGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917058146 1:171006472-171006494 GAGGTGTGGGGGAGGGAGGAAGG - Intronic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
917417058 1:174821242-174821264 CGGGAATGAGGGAATGAGGAAGG + Intronic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
917511284 1:175671176-175671198 CAGGCTTGGGGGAAAGACGATGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918149138 1:181783041-181783063 CAGGCTCTGGGGTAGGAGGATGG - Intronic
918273310 1:182924822-182924844 GAGGGGTGGGGGAAGGAGGGAGG + Intronic
918362838 1:183776615-183776637 CAGGAGTGAGGGATGGAGGCGGG + Intronic
918403905 1:184192795-184192817 CAGGGTTGGGGGTGGGAGGGTGG + Intergenic
918429932 1:184449190-184449212 TAGGGTGGGGGGAAGGGGGAGGG - Intronic
918626522 1:186661895-186661917 CAGGTGGGGGGGAAGGGGGAGGG - Intergenic
918725680 1:187919680-187919702 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
919281411 1:195494798-195494820 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
919417146 1:197325200-197325222 CAGGATTGGGGTGGGGAGGGAGG - Intronic
919491115 1:198205936-198205958 TGGGTTTGGGGGAAAGAGGAGGG + Intronic
920106393 1:203556331-203556353 CAGGGTTGGGGGATGGGGGGTGG + Intergenic
920127397 1:203704250-203704272 AAGGACTGGAGGAAGAAGGAAGG + Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920307951 1:205031054-205031076 CAGGAAAGGGGGAAGGAGAGAGG + Intergenic
920354487 1:205360460-205360482 CAGGATTTGGGGGAGGACAAAGG - Intergenic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920924804 1:210330766-210330788 ATGGACTGGGGGAAGGGGGATGG + Intronic
921092921 1:211860222-211860244 CAGGACCAGGGGAAGAAGGAAGG + Intergenic
921829063 1:219706725-219706747 CAGGGTTGGGGGCCAGAGGAGGG + Intronic
922355123 1:224767993-224768015 TGGGGCTGGGGGAAGGAGGAGGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
923107326 1:230864819-230864841 GAAGATTGGGGGCAGGAGCAGGG + Intronic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
923538254 1:234869622-234869644 CTGGTTTGGAGGGAGGAGGATGG - Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923748190 1:236722933-236722955 CTGGATTTGGGGTTGGAGGAGGG + Intronic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
923857371 1:237859415-237859437 CAGGATTGGGGGTGAGGGGACGG + Intergenic
924039668 1:239971929-239971951 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
924217094 1:241833931-241833953 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
924261448 1:242235557-242235579 CAGGATTTGGGGGAGAAGGAGGG + Intronic
924310323 1:242734675-242734697 TAGGGTTGGGGGAAGGAGGTGGG + Intergenic
924431708 1:244002913-244002935 CTGAATTGGGGGAAGGAATATGG + Intergenic
924616691 1:245617903-245617925 CAGGCCTGTGGGAAGGAGCAGGG - Intronic
924633401 1:245763210-245763232 CATTATTGAGGGAAGGAGGAGGG - Intronic
924830748 1:247592276-247592298 GGGGATTGGGGGAAAGGGGAGGG - Intergenic
924897379 1:248356049-248356071 GGGGGTTGGGGGAAAGAGGAGGG + Intergenic
1063025946 10:2178852-2178874 GAGGATTGAAGGAAGGAGGAAGG - Intergenic
1063230324 10:4060083-4060105 TAGGGTTGGTGGAAGGAGGGTGG - Intergenic
1063332448 10:5175116-5175138 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1063673562 10:8119356-8119378 CAGGAGTGGGGGAATGAGTTGGG + Intergenic
1063711414 10:8482713-8482735 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1064149384 10:12849951-12849973 AAGCATGGGGGGAAGGAGGGAGG - Intergenic
1064652100 10:17519652-17519674 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064953731 10:20883276-20883298 CAGGATTGGAGGTAGGAACATGG - Intronic
1064961622 10:20971587-20971609 TAGGGTTGGGGGAGGGGGGAGGG - Intronic
1065133451 10:22644998-22645020 CAGCATAGGGGGAAGGGGGTAGG - Intronic
1065464910 10:26009227-26009249 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1066462695 10:35625437-35625459 GAGGATGGAGGGTAGGAGGAAGG - Intergenic
1066583566 10:36907597-36907619 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1066782908 10:38971880-38971902 AGGTATTGGGGGAAAGAGGAAGG - Intergenic
1067187079 10:44039148-44039170 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067458612 10:46441114-46441136 GGGGAGTGGGGGAAGGAGGGAGG - Intergenic
1067628584 10:47943522-47943544 GGGGAGTGGGGGAAGGAGGGAGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1067848181 10:49739135-49739157 CAGGAAGGGAGGAAGGAGCAGGG - Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068403351 10:56558348-56558370 GGGGGTTGGGGGAAAGAGGAGGG + Intergenic
1068493902 10:57760002-57760024 GAGGATGGAGGGCAGGAGGAGGG + Intergenic
1068525218 10:58120994-58121016 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068932171 10:62602897-62602919 TGGGGTGGGGGGAAGGAGGAGGG - Intronic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069894707 10:71673220-71673242 AAGGGTTTGGGGAAGGACGAGGG - Intronic
1069994147 10:72332365-72332387 GAGGATGGTGGGAAGGACGATGG + Intergenic
1070167455 10:73909594-73909616 CAGGAAGGTAGGAAGGAGGAAGG - Intronic
1070263028 10:74876201-74876223 GGGGAGTGGGGGAAGAAGGAGGG - Intronic
1070578439 10:77698524-77698546 CAGCAATGGGGGAGGGAGTAAGG + Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070828226 10:79403558-79403580 CAGGATGCTGGGAGGGAGGAAGG + Intronic
1070984888 10:80680161-80680183 AAGGTCTGGGGGAAGGAGCATGG - Intergenic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071333639 10:84584803-84584825 CTGGCTTGGGGGCAGGAAGATGG + Intergenic
1071628494 10:87197933-87197955 TAGGGTTGGGGGAAAGAGGGTGG - Intergenic
1071715675 10:88093025-88093047 CAGGATTCAAGGTAGGAGGATGG + Intergenic
1071992685 10:91115299-91115321 CAGGATGGTAGGAAGGAGTATGG + Intergenic
1072017233 10:91360241-91360263 CAGGATTGGGCCAAGGGAGAAGG - Intergenic
1072189561 10:93068847-93068869 CCGGACTCGAGGAAGGAGGAGGG + Intergenic
1072196653 10:93121890-93121912 AAGGAGTGAGGGAAGGTGGACGG - Intergenic
1072203775 10:93184116-93184138 GAGGGTTGGGGGTGGGAGGAAGG - Intergenic
1072317687 10:94219596-94219618 CAGGCTTGCAGGAAGGAGTATGG + Intronic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072615036 10:97043519-97043541 GAGGAACGGGGGAGGGAGGAGGG + Intronic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1073131216 10:101190278-101190300 CAGGAGTGGGGGTAGAAGGTGGG + Intergenic
1073291575 10:102415919-102415941 AAGGATTGGGGGAAGTTTGAAGG + Intronic
1073611342 10:104946939-104946961 CAGGAATGGGGACAGCAGGATGG + Intronic
1073745153 10:106459955-106459977 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
1073806365 10:107103029-107103051 CAGGAGTGTTGGAAGGAGAAAGG - Intronic
1073813482 10:107178001-107178023 GAGCATTGGGGGTGGGAGGAAGG + Intergenic
1074051208 10:109882768-109882790 CAGGATTTGGGAAAGGAGTGGGG - Intronic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1074998842 10:118780182-118780204 AAGGAATGGAGGGAGGAGGAAGG - Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075449136 10:122536069-122536091 GCGTATTGGGGGAAGGAGGCTGG + Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1076076387 10:127537190-127537212 CAGGAAGGAGGGAAGCAGGAAGG + Intergenic
1076449686 10:130548372-130548394 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1076450971 10:130556744-130556766 CAGGATTTGGGAAAGGTGCAGGG + Intergenic
1076582385 10:131520371-131520393 CAGGGTTGGGGGCAGGACGAGGG - Intergenic
1076638715 10:131900253-131900275 CAGGATTGGGAGACCGAGGCCGG + Intergenic
1076996356 11:299234-299256 CAAGGTGGGGGGAAGGGGGAGGG - Intronic
1077053627 11:579228-579250 CAGGGCTGGGGGGAGGAGCAGGG - Intronic
1077053635 11:579246-579268 CAGGGCTGGGGGGAGGAGCAGGG - Intronic
1077063104 11:626348-626370 CAGGATGGGGGAGAGGGGGAGGG - Intergenic
1077247752 11:1547568-1547590 CAGGATTGAGGGCAGTAGGACGG - Intergenic
1077271558 11:1684414-1684436 CATGTGTCGGGGAAGGAGGAGGG + Intergenic
1077528531 11:3083718-3083740 TGGGAATGAGGGAAGGAGGAGGG - Intergenic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077790721 11:5437035-5437057 TGGTATTGGGGAAAGGAGGAGGG + Intronic
1078112703 11:8411418-8411440 CATTATTTAGGGAAGGAGGAAGG + Intronic
1078222553 11:9363999-9364021 TAGGAGTGGGGGTAGGAGTAGGG + Intergenic
1078421339 11:11215539-11215561 CAGGAGTGGAGAGAGGAGGACGG + Intergenic
1078450801 11:11439256-11439278 CAGAAGTGGGGCAAAGAGGATGG + Intronic
1078724755 11:13920152-13920174 CAGGTTTTGGGGGAGGAGTAAGG - Intergenic
1078828734 11:14957232-14957254 AAGGATTTGGGGGAGGAAGAGGG - Intronic
1078892284 11:15567971-15567993 CAGGATTGGGGAAAGGACTGAGG + Intergenic
1079078563 11:17398200-17398222 CAGGGCTGGGGGAAGCAGGAAGG + Intronic
1079138595 11:17792417-17792439 CAGGGATGGGGGTGGGAGGAAGG + Intronic
1079330152 11:19526548-19526570 CAGGATTGGATGAAGAAGAAGGG + Intronic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1079777526 11:24551430-24551452 CTTGAGTGGGGGAAGGAGAATGG + Intronic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080153555 11:29080112-29080134 AAGGATAGAGGGTAGGAGGAGGG + Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080612680 11:33918174-33918196 CACCCTTGGGGGAATGAGGAGGG + Intergenic
1080879486 11:36306233-36306255 CAGGATGGGGGGCTGGGGGAGGG - Intronic
1081575830 11:44318083-44318105 TAGGAGTGGGGAAAGGAGGGAGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081915786 11:46729361-46729383 CAAGCTTTGGGGAAGGAAGAAGG - Exonic
1082076850 11:47981204-47981226 CAGGATCGGGGGAGAGAGGCGGG + Intronic
1082138117 11:48574440-48574462 TGGGATGGGGGGAGGGAGGAGGG - Intergenic
1082311475 11:50654458-50654480 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1082598203 11:55111714-55111736 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082911833 11:58385928-58385950 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1082913586 11:58405597-58405619 GAGGATGGTGGGTAGGAGGAGGG + Intergenic
1082914428 11:58416141-58416163 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083051840 11:59784335-59784357 CAGGATTGAGGGAGGGAAAAAGG - Intronic
1083174343 11:60939772-60939794 CTGGACTGGGGGGTGGAGGAGGG + Intronic
1083185236 11:61013808-61013830 AAGTGTTGGGGGAATGAGGAGGG + Intronic
1083318277 11:61829237-61829259 CGGGATTGGTGGAAGGAGAACGG + Intronic
1083478448 11:62928480-62928502 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1083527973 11:63389323-63389345 GGGGGTTGGGGGAAGGGGGAGGG - Intronic
1083732525 11:64660543-64660565 CAGGAGTTGGGGAAGAGGGAAGG + Intronic
1083827697 11:65212505-65212527 GTGGTTTGGGGGAAGGAAGAGGG + Intergenic
1084106285 11:66982977-66982999 CAGGATTCTGGGAAGGTGAAGGG - Intergenic
1084147056 11:67270550-67270572 CAGGAGTGAAGGAAGGAGGGAGG - Intronic
1084304296 11:68271764-68271786 GAGGTTGGGGGGCAGGAGGAGGG - Intronic
1084444024 11:69193103-69193125 GGGGATTGGGGGAAGTAAGAGGG - Intergenic
1084447438 11:69212097-69212119 TTGGGTTGGGGGACGGAGGAGGG - Intergenic
1084457125 11:69274308-69274330 CAGGAATTGAGGAAGGAGGGAGG + Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084560295 11:69901495-69901517 GAGAGTTGGGGGAAGGCGGAAGG - Intergenic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085088367 11:73688773-73688795 CAGGATTGGGAGAACCTGGAAGG - Intronic
1085322756 11:75584608-75584630 AAGGACTGGGAGGAGGAGGAAGG + Intergenic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085569526 11:77547282-77547304 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1085743068 11:79093441-79093463 TAGGAATGGGGGAAGTAGAAAGG - Intronic
1086109078 11:83179165-83179187 CAGTGTTGGGTGAAGGAGAAAGG - Intronic
1086142257 11:83512214-83512236 CAGGATTGGGGGAGAGAAGAGGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086396741 11:86423143-86423165 TAGGACTGGGGGAAGAGGGAGGG - Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086564133 11:88205506-88205528 GAAGAATGGGGTAAGGAGGATGG + Intergenic
1086853037 11:91833566-91833588 AAGGAAGGTGGGAAGGAGGAAGG + Intergenic
1086860428 11:91918843-91918865 TGGGGTTGGGGGGAGGAGGAAGG + Intergenic
1087136832 11:94729650-94729672 CAGATTTGAGGGATGGAGGAGGG - Intronic
1087203716 11:95372303-95372325 CAGGGTTGGGGGAAGCAGACAGG + Intergenic
1087514424 11:99140349-99140371 AAGGATGGAGGGTAGGAGGAGGG - Intronic
1087607194 11:100391072-100391094 GAGGGTTGGGGGTGGGAGGAGGG + Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088545303 11:110952970-110952992 CAGGCCTGCAGGAAGGAGGAGGG + Intergenic
1088723182 11:112612404-112612426 CAGGGTTGGGGGTGGGAGGGGGG + Intergenic
1088835749 11:113576816-113576838 CAGGAGTGTGGGAAGGGGTATGG - Intergenic
1088881281 11:113975357-113975379 CAGGAGTGTGGGGAGGAGCAAGG - Exonic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089089378 11:115856782-115856804 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1089133636 11:116232101-116232123 AAGGGCTGGGGGAAGGAGGTGGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089581119 11:119482569-119482591 CAGGCTTGGGGCCAGGAGGCAGG + Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1089875769 11:121720370-121720392 AAGGATTCTGGGAAAGAGGACGG - Intergenic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090264071 11:125343097-125343119 CAGGAATGGAGGCAGGAGGGAGG - Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090515031 11:127416018-127416040 TAGGGTTGGGGGAAGGGGGAGGG - Intergenic
1090666408 11:128917720-128917742 CAGGAATGGGGCAAAGAGAAAGG + Exonic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1090906176 11:131076425-131076447 ATGGATTGGGGGAAGGCGAATGG - Intergenic
1090989543 11:131803741-131803763 CAGGTTCGGGGGAGGCAGGAAGG - Intronic
1091106484 11:132924230-132924252 AATGCTTGGGGGATGGAGGATGG + Intronic
1091666211 12:2420242-2420264 AAGGATGGAGGGAAAGAGGAGGG - Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091976158 12:4827271-4827293 AAGGAAGGAGGGAAGGAGGAGGG - Intronic
1092160408 12:6312493-6312515 CTGGGTTGCGGGAAAGAGGAGGG + Intronic
1092257434 12:6935207-6935229 AGGGCTTGGGGGATGGAGGATGG + Intronic
1092288089 12:7141435-7141457 CAGGATTTGGGAAGGGAGGTAGG + Intronic
1092588593 12:9926573-9926595 GAGTTTTGGGGGAATGAGGAAGG + Intronic
1092972644 12:13712229-13712251 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1094037206 12:26084067-26084089 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1094088215 12:26617705-26617727 AAGGAAGGAGGGAAGGAGGAAGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1095246435 12:39929034-39929056 CAGGATTGCAGACAGGAGGATGG + Intronic
1095634451 12:44416357-44416379 GAGGGTTGGGGGAAAGGGGAAGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096448854 12:51720455-51720477 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096741671 12:53697870-53697892 CAGGATTTAGGGAATTAGGAGGG - Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096867029 12:54570743-54570765 CAGAACTGGGGGACGGGGGAGGG - Intronic
1096916570 12:55039790-55039812 CAGGATTTGGTGAGGGGGGAAGG - Intergenic
1096958895 12:55557433-55557455 AAGGGTGGGGGGCAGGAGGAGGG - Intergenic
1097013714 12:55970834-55970856 CATGGTTGGGGGAAGGAAGGAGG + Intronic
1097371387 12:58785661-58785683 CCTTATTGGGGAAAGGAGGAAGG + Intronic
1097831778 12:64232604-64232626 CAGGATTGGGCAGAGGGGGAGGG - Intergenic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098229496 12:68358620-68358642 CAAGAGTGGGGGAAGGGAGAGGG + Intergenic
1098477422 12:70921025-70921047 CAAGATTTGGGGAAAGAGTAGGG - Intergenic
1098496642 12:71143339-71143361 AAGGGTTGGGGGAAGAGGGAGGG - Intronic
1098521527 12:71439652-71439674 CAGGACTTGGGAAAGGAGGGAGG + Intronic
1099385305 12:82006243-82006265 GGGGAAGGGGGGAAGGAGGAAGG + Intergenic
1099590766 12:84586249-84586271 CAGGATTAGAGCAAGTAGGAAGG - Intergenic
1100384070 12:94089849-94089871 CTAGATTGTGGGATGGAGGAAGG - Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101231186 12:102743240-102743262 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1101243477 12:102861829-102861851 TGGGGTTGGGGGAAGGGGGAGGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101925623 12:108969236-108969258 AAGGAGGGAGGGAAGGAGGAGGG - Intronic
1101952440 12:109187143-109187165 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1102096636 12:110246489-110246511 CAGAATTGGGGCAAGGGAGAAGG - Intergenic
1102432413 12:112893948-112893970 AAGGAGTGGGGTGAGGAGGATGG + Intronic
1102451505 12:113045079-113045101 GGGGAGTGGGGGAAGGAGGGAGG + Intergenic
1102504216 12:113373696-113373718 AAGGATGGGTGGATGGAGGATGG - Intronic
1102514589 12:113437859-113437881 CAGGATCGGGGGATGGAGAGAGG - Intronic
1102536757 12:113587685-113587707 AAGGAGTGGGGGAAGTGGGAAGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102703138 12:114857563-114857585 GAGGATGGAGGGCAGGAGGAGGG - Intergenic
1103188283 12:118980346-118980368 CGGGGTTGGGGGGAGGGGGAGGG + Intergenic
1103309227 12:119990421-119990443 AATGAATGGGGGAGGGAGGATGG + Intronic
1103316995 12:120064247-120064269 CAGGAGCGGGGAAAGGAAGACGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103376121 12:120457378-120457400 CAGGATTGGGGGCATGCGGGAGG + Intronic
1103458444 12:121085641-121085663 GAGGATTTGGGAAAGGAGTAAGG - Intergenic
1103746057 12:123124711-123124733 CCGGGTTGGGGGATGGGGGAGGG - Intronic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104383803 12:128331125-128331147 CAGGATTGGGGAGCAGAGGAAGG - Intronic
1104476498 12:129074659-129074681 CAGGAATGGGGGAGTCAGGAAGG - Exonic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1104863968 12:131941813-131941835 CTGGACTGGGCGCAGGAGGAAGG + Exonic
1104920597 12:132288623-132288645 CAGCGTTGGGGGCAGGAGGGTGG + Intronic
1104920628 12:132288736-132288758 CAGCATTGGGGGCAGGAGGGTGG + Intronic
1105260068 13:18772552-18772574 GAGGGTTGGGGGTAGTAGGAAGG - Intergenic
1105350603 13:19611891-19611913 TGGGGTTGGGGGAAGGAGGGAGG - Intergenic
1105424828 13:20285166-20285188 GGGGATCGAGGGAAGGAGGATGG + Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106234108 13:27846934-27846956 CACCATTGTGGGGAGGAGGAAGG + Intergenic
1106242224 13:27921117-27921139 CAGGATAGGAGTAAAGAGGAAGG + Intronic
1106466502 13:30018819-30018841 GAGGAGTGGAGGAAGGATGAGGG - Intergenic
1106552159 13:30781429-30781451 TGGGATGGGGGGAAGGGGGAGGG - Intergenic
1106620667 13:31367758-31367780 GGGGATTGAGGGGAGGAGGATGG + Intergenic
1106754497 13:32809370-32809392 CTGGCTTGGAGGATGGAGGAAGG - Intergenic
1106904071 13:34386590-34386612 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1106986414 13:35357440-35357462 CAGGGTGGAGGGTAGGAGGAGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107047179 13:36006015-36006037 GAGGGTCGGGGGAAAGAGGATGG + Intronic
1107382750 13:39875195-39875217 AAGGAGTGGGGCAAGGGGGAAGG + Intergenic
1107690296 13:42946926-42946948 CATGAATGGGGCAAGGGGGATGG - Intronic
1108061652 13:46539080-46539102 GAGGTTTGGGGGAAGGAAGGGGG - Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108307354 13:49151716-49151738 CAGGTTGGGGGGATGGGGGAGGG - Intronic
1108431978 13:50362456-50362478 GGGGTTTGGGGGAGGGAGGAGGG - Intronic
1108547423 13:51509857-51509879 TGGGGTTGGGGGAAGGGGGAAGG - Intergenic
1108696154 13:52904327-52904349 CAGGATTGGAGAAAGGCAGAGGG + Intergenic
1109181545 13:59219986-59220008 GAGGAAGGGGGGAAGGGGGAAGG + Intergenic
1109740690 13:66550759-66550781 CAGATTTGTGGGAAGGAAGAGGG + Intronic
1109980725 13:69902755-69902777 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1110122032 13:71894321-71894343 TGGGATGGGGGGAAGGGGGAGGG + Intergenic
1110149589 13:72234759-72234781 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1110836015 13:80083852-80083874 CAGAATTGGAGGGAGCAGGAGGG + Intergenic
1110849974 13:80233705-80233727 CATGAATGGGGGCAGGAGCAGGG + Intergenic
1111144372 13:84161376-84161398 CAGGGGTGGGGGACGGGGGAGGG - Intergenic
1111265468 13:85806618-85806640 TAGATTTGGGGGAAGAAGGAAGG + Intergenic
1111457312 13:88502122-88502144 CAGGGTGGGGGGTGGGAGGAGGG - Intergenic
1111951777 13:94713501-94713523 CAGGACTCGGGGAGGGAGGAGGG + Intergenic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112458550 13:99583344-99583366 CAGGGATGGAGGGAGGAGGAAGG - Intergenic
1112485770 13:99818059-99818081 AAGAAGTGAGGGAAGGAGGAAGG + Intronic
1112498098 13:99921195-99921217 CAAGATTGGGGGGAGGGGGGAGG - Intergenic
1112522270 13:100106993-100107015 CAGGAATCCGGGAAGGAGAAAGG - Intronic
1113362986 13:109648687-109648709 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113741381 13:112714470-112714492 CAGGGTTCGGGGAGTGAGGAGGG - Intronic
1113755535 13:112808479-112808501 CAGTAGTGGGGGAAGGTCGAGGG - Intronic
1113909938 13:113836884-113836906 GGGGAGTGGGGAAAGGAGGAGGG + Intronic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114490020 14:23094700-23094722 AGGGGGTGGGGGAAGGAGGAAGG + Intronic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1114669600 14:24402024-24402046 CAGGACTGGGGGAGGGCTGATGG + Intronic
1114877265 14:26735907-26735929 AAGGGTTGAGGGTAGGAGGAAGG + Intergenic
1115030163 14:28785272-28785294 CAGGCTTCGGGGAAGGAGGGAGG + Intronic
1115188465 14:30719949-30719971 CAGAATTGGGGGCAGGGGGGTGG + Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115822604 14:37227617-37227639 CAGCATTGAGGGAAGTAGGCTGG + Intronic
1116021763 14:39469691-39469713 GAGGATGGGGGCAGGGAGGAGGG + Intergenic
1116190115 14:41654048-41654070 TGGGGTTGGGGGAAGGGGGAGGG + Intronic
1116514392 14:45787851-45787873 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1116550220 14:46227784-46227806 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1117079068 14:52132810-52132832 TGGGATTGGGGGAAGGGGGAAGG + Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117401098 14:55358935-55358957 CAGGTCTGGTGGAAGGAGGAGGG + Intronic
1117438729 14:55741369-55741391 GAGGCCTGGGGGAAGGAGGAGGG + Intergenic
1117478179 14:56118337-56118359 CGGGAGGGAGGGAAGGAGGAGGG - Intronic
1118131269 14:62966766-62966788 CAGGATTGGAGGAAACAGCAAGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118355839 14:65012988-65013010 CAGGACTGGGTGACGGTGGAGGG + Intronic
1118605059 14:67496766-67496788 CAGAAATGAGGGAGGGAGGAAGG - Intronic
1118634967 14:67739974-67739996 CAGGAATGGGGGTGGGAGGGTGG + Intronic
1118910243 14:70056084-70056106 TAGGAATGGAGGAATGAGGATGG + Intronic
1118975357 14:70671708-70671730 AACGAGTGGGGGAAGGAGGCAGG - Exonic
1119235428 14:73015374-73015396 AAGGAAGGGGGGAAGGAAGAGGG + Intronic
1119522370 14:75295367-75295389 CAGGGATGGGGGTGGGAGGATGG - Intergenic
1119889683 14:78173550-78173572 CAGAATTGGGGGAGGATGGAGGG - Intergenic
1120175698 14:81291034-81291056 CAGGATAGGAGGAAGTAGGGAGG + Intronic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120608402 14:86608617-86608639 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1121067958 14:90986888-90986910 CAAGAGTGAGGGAAGGAGGGTGG - Intronic
1121173150 14:91871004-91871026 CAGGGTGGGAGGCAGGAGGAGGG + Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121897743 14:97664279-97664301 CAGGCTTGGGAGAAGAAGTATGG - Intergenic
1122040072 14:98981119-98981141 CAGGGTTGGGGGAAGGGGAATGG + Intergenic
1122092351 14:99348902-99348924 CAGGACAGGGGGAAGCAAGAAGG + Intergenic
1122144992 14:99683864-99683886 CAGGTTTGGGGGAAAAAGGAAGG + Intergenic
1122153675 14:99737973-99737995 CAGGCGTCGGGCAAGGAGGAAGG - Intronic
1122199432 14:100113564-100113586 AAGGATTTGGGCTAGGAGGAGGG + Intronic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122437407 14:101709508-101709530 CAGGGGTGGGGGATGGGGGAGGG + Intergenic
1122977255 14:105175935-105175957 GAGGTCTTGGGGAAGGAGGAGGG - Intronic
1123058856 14:105585447-105585469 AAGGATGGGTGGATGGAGGATGG - Intergenic
1123083207 14:105705777-105705799 GAGGATTGGTAGACGGAGGATGG - Intergenic
1123112596 14:105880235-105880257 CAGGTGTGGGGGGATGAGGAGGG + Intergenic
1123175064 14:106409122-106409144 TGGGGTTGGGGGAAGGGGGATGG + Intergenic
1202917200 14_GL000194v1_random:186377-186399 TGGGATGGGGGGAAGGGGGAGGG + Intergenic
1202929458 14_KI270725v1_random:25638-25660 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1202943619 14_KI270726v1_random:6655-6677 GGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1123445883 15:20329812-20329834 CAGGCTTTGAGGATGGAGGAAGG - Intergenic
1123895534 15:24825950-24825972 CAGGTTTGGGTCAAGGGGGAGGG + Intronic
1124016318 15:25878985-25879007 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
1124176471 15:27429579-27429601 CAGGATCTGGGGAAAGAGAATGG - Intronic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1124259727 15:28178082-28178104 GAGGGTTGGGGGAAGAAGCAGGG - Intronic
1124367998 15:29087728-29087750 CTGGAGTGGGGAAAGGAGGCAGG - Intronic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124410229 15:29430702-29430724 AAGGATGGGAGGAAGGAGGGAGG + Intronic
1124841108 15:33243048-33243070 TAGGCCTGGAGGAAGGAGGATGG - Intergenic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1125101514 15:35918464-35918486 AGGGATTGGGGGAAGGAAGAAGG + Intergenic
1125119515 15:36137857-36137879 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1125167120 15:36720418-36720440 TAGGGTCGGGGGAGGGAGGAGGG - Intronic
1125448861 15:39787018-39787040 CAGGATTGGGAGATGCTGGAGGG - Intergenic
1125479175 15:40069078-40069100 CAGGAGTGGGGCAGGCAGGACGG - Intergenic
1125536692 15:40444834-40444856 GAGGTTTGGGGGAAAGGGGATGG - Intronic
1125577796 15:40767192-40767214 CAGGATGGGGGGGGTGAGGAGGG - Exonic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1125701487 15:41689344-41689366 AAGGAAGGGAGGAAGGAGGAGGG - Intronic
1125751367 15:42031560-42031582 GAGGACTGTGGGATGGAGGAGGG - Intronic
1125790482 15:42361765-42361787 CAGGATCTGGGGAAAGAGGATGG - Intronic
1126213292 15:46125274-46125296 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1126853181 15:52811247-52811269 TAGGATTTGGGGAAGTGGGAGGG + Intergenic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127274228 15:57428087-57428109 CAGAAATGTGGCAAGGAGGAAGG + Intronic
1127282269 15:57502408-57502430 CAGATATGGGGGAAGGTGGAAGG + Intronic
1127370990 15:58340740-58340762 GGGGATTGGGGGCTGGAGGAGGG + Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1127959829 15:63882521-63882543 CAGGCCTGAGGGAGGGAGGAAGG - Intergenic
1128259286 15:66221296-66221318 CAGGAGTGTGGGAGGGAGGCAGG - Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128499961 15:68221214-68221236 GAGGGTTGGGGGAGGGGGGAGGG - Intronic
1128647446 15:69387881-69387903 CAGGTCTGGGGGTTGGAGGAAGG - Intronic
1128745561 15:70111734-70111756 GAGGCTTGGGGGGAGGGGGAGGG + Intergenic
1129207095 15:74043836-74043858 GGGGATTGGAGGAAGGAGCATGG + Intronic
1129227125 15:74176503-74176525 CAGGATTGGGGGAATGGAGCTGG + Exonic
1129250177 15:74304408-74304430 GAGGGATGGGGGAAGGAGGGAGG - Intronic
1129379065 15:75154226-75154248 GAGGATTGGGAGAAGAAAGAGGG - Intergenic
1129698368 15:77753526-77753548 GAGGACTGGGGGTAGGGGGAGGG + Intronic
1130050833 15:80482310-80482332 CAGGATTGGGGAAGGGAGCTGGG + Intronic
1130417736 15:83709794-83709816 TAGGCATGGGGGAAGGTGGAAGG + Intronic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130542940 15:84835059-84835081 CAGGGGTGGGGCAAGGAGGGAGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131065945 15:89435337-89435359 CAGGAACGGGCGACGGAGGAGGG - Intergenic
1131067961 15:89446099-89446121 CAGGGCTGGAGGAAGGGGGAAGG + Intergenic
1131433551 15:92405313-92405335 CAGGGTCTGGGGAAGGAGAAGGG + Intronic
1131649872 15:94387129-94387151 GAGGAAGGGGGGAAGGAGGAAGG - Intronic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132647945 16:1007702-1007724 CAGGAGTGGGAGAAGGATGCGGG - Intergenic
1132882697 16:2169541-2169563 CAGGCCTGGGGGACGGGGGAAGG - Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133121416 16:3611186-3611208 CCGGGTTGGGGGAAGCGGGAGGG - Intronic
1133410960 16:5568433-5568455 CAGGAAAGGGGGAAAGAGAAGGG - Intergenic
1133545805 16:6805388-6805410 GAGGATAGAGGGTAGGAGGAGGG + Intronic
1133551161 16:6855814-6855836 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1133725238 16:8531030-8531052 CAGGACGGAGGGAAGAAGGAAGG + Intergenic
1133814159 16:9183799-9183821 CAGGATTGGGGGGGGGGGGGCGG - Intergenic
1133826766 16:9284845-9284867 AAGGAATGAGGGAAGGAGGGAGG - Intergenic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134215132 16:12311428-12311450 CAGGAAAGGAGGACGGAGGAGGG - Intronic
1134239093 16:12491670-12491692 TGGGGTTGGGGGAAGGGGGAGGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1134628357 16:15739077-15739099 CAGCAGTGGGGGATAGAGGAAGG - Intronic
1134948712 16:18342128-18342150 GAGGAGGGGAGGAAGGAGGAGGG + Intergenic
1135007457 16:18839334-18839356 GAGGGTGGGGGGCAGGAGGAGGG - Intronic
1135068527 16:19332228-19332250 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1135070053 16:19343997-19344019 CAGGATTGGGGAAAAGAGGAAGG - Intergenic
1135416087 16:22268988-22269010 GAGGATGTGGGGAAGGTGGAAGG - Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136073927 16:27805162-27805184 TGGGATTGGGGGTGGGAGGAGGG + Intronic
1136110135 16:28059473-28059495 GAAGATTGGGGGGAGGTGGAGGG - Intronic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136268022 16:29132159-29132181 GAGGATGGAGGGAGGGAGGAAGG + Intergenic
1136597307 16:31260201-31260223 GGGGATTTGGGGAAGGAGAAAGG + Intronic
1136724069 16:32343141-32343163 CGGCATTGGGGGATGGAGGTGGG - Intergenic
1136772874 16:32857176-32857198 CGGCATTGGGGGATGGAGGTGGG + Intergenic
1136842403 16:33549185-33549207 CGGCATTGGGGGATGGAGGTGGG - Intergenic
1136897740 16:34004343-34004365 CGGCATTGGGGGATGGAGGTGGG - Intergenic
1137384580 16:48029775-48029797 GAGGCACGGGGGAAGGAGGAGGG + Intergenic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1137683373 16:50369421-50369443 GAAGAGTGGGGGAAGGAGGAAGG - Intergenic
1137724171 16:50645951-50645973 CAGGAGAGGGGAAAGGAGGGAGG + Intergenic
1137780407 16:51093543-51093565 CAGGATTGGTGGAAACAGCAAGG + Intergenic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1137907613 16:52339380-52339402 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1138088930 16:54158370-54158392 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1138093520 16:54194844-54194866 GAAGAATGGGAGAAGGAGGAGGG + Intergenic
1138101645 16:54256661-54256683 GAGGATTAGAGAAAGGAGGAGGG - Intronic
1138206172 16:55126780-55126802 GAGGATGGTGGGGAGGAGGAAGG - Intergenic
1138396103 16:56705825-56705847 CAAGGTTGGGGGAGGGAGGAAGG - Intronic
1138458811 16:57135973-57135995 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1138464899 16:57182383-57182405 TAGGGTGGGGGGAGGGAGGATGG - Intronic
1138519107 16:57560668-57560690 CAGGATTGGGGATGGTAGGATGG + Intronic
1138546295 16:57721883-57721905 CAGGAAGGGGGGAGGGAGGGAGG - Intronic
1138653196 16:58473530-58473552 AAGGTTTGGGGGAAAGATGAGGG - Intronic
1139117932 16:63979567-63979589 AAGGGTTGGGGGAAAGGGGAGGG - Intergenic
1139147197 16:64339493-64339515 CAAGAATGGGGGAAGGGGGATGG - Intergenic
1139304307 16:65970272-65970294 CAGGGGTGGGGGTAGGGGGAGGG - Intergenic
1139366113 16:66434460-66434482 CTGGAGTGGGGGAAGGGAGAAGG + Intronic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140339399 16:74142012-74142034 CAGAATTGTGGGCGGGAGGAAGG - Intergenic
1140887591 16:79258627-79258649 CAGGCTTTGGGGAAGGAACAAGG + Intergenic
1140920672 16:79534587-79534609 TGGGATGGGGGGAGGGAGGAGGG + Intergenic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1141604814 16:85146728-85146750 TGGGAATGGGGGAATGAGGAGGG + Intergenic
1141765730 16:86058872-86058894 CAGGATTGGGGGAGGGGGCAGGG + Intergenic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1142247557 16:88976883-88976905 CAGCCTTGAGGGAAAGAGGAGGG + Exonic
1142266618 16:89066911-89066933 CAGGATCGGGGGTACCAGGAGGG - Intergenic
1142420365 16:89966200-89966222 CTGCATTGGGGGAAGGATGGGGG - Exonic
1203002362 16_KI270728v1_random:174624-174646 CGGCATTGGGGGATGGAGGTGGG + Intergenic
1203075298 16_KI270728v1_random:1119286-1119308 CGGCATTGGGGGATGGAGGTGGG + Intergenic
1203133967 16_KI270728v1_random:1711030-1711052 CGGCATTGGGGGATGGAGGTGGG + Intergenic
1203152568 16_KI270728v1_random:1849482-1849504 CGGCATTGGGGGATGGAGGTGGG - Intergenic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142982149 17:3678556-3678578 CAGCAGTGGGGCAAGGAGGCTGG - Intronic
1143037357 17:4007055-4007077 GAGGATGTGGGGACGGAGGAGGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143490669 17:7283662-7283684 CAGGGGTGGGGGAAACAGGAAGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143566138 17:7721901-7721923 GAGGAGTGGGGGAAGATGGAGGG + Intronic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1144091486 17:11861167-11861189 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1144623878 17:16834579-16834601 GAGGACTGGAGGGAGGAGGAGGG + Intergenic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1144882551 17:18438137-18438159 GAGGACTGGAGGGAGGAGGAGGG - Intergenic
1145149683 17:20506249-20506271 GAGGACTGGAGGGAGGAGGAGGG + Intergenic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1145206931 17:20989596-20989618 CAGGCTTGGGGGTAGGTGCAGGG + Intergenic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1145761390 17:27427163-27427185 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1145879332 17:28342146-28342168 CAGGATGGGGGAAGGGAGGGAGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146214812 17:30970917-30970939 CAGGATCGGAGGAAGGAGACGGG + Exonic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146647216 17:34583307-34583329 CAGGACTCAGGGAAGGAGGTTGG - Intronic
1146688390 17:34856811-34856833 CAGGATGGGGGTGCGGAGGATGG + Intergenic
1146773950 17:35595640-35595662 TTTGATTGGGGGGAGGAGGAGGG + Intronic
1146829478 17:36055938-36055960 CTGGATAGGGGGAAGAAGAAGGG + Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147305934 17:39564417-39564439 CAGGATTGGTGGTAGGAGGAAGG - Intronic
1147565609 17:41534832-41534854 CAGGGGTGGGGGCACGAGGATGG - Intergenic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147717542 17:42518580-42518602 CTCGAGTGGGTGAAGGAGGAAGG - Intronic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148053324 17:44779758-44779780 CAGGCTTGGAGGGAGGAGGGTGG - Exonic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148233497 17:45951875-45951897 CAGGATTGAGGAAAGGAGAAAGG + Intronic
1148321434 17:46757510-46757532 TAGGAATGGAGGAAGAAGGAGGG + Intergenic
1148453632 17:47798205-47798227 CAGGATTGGGTGGAGAAGGAAGG - Intergenic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148754538 17:49965815-49965837 AAGAAGTGGGGGGAGGAGGAGGG - Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148853444 17:50565822-50565844 CAGGAGGGAGGAAAGGAGGAGGG + Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149349932 17:55776321-55776343 CAGGATGGGGGGAGCGAGAAAGG - Exonic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1149996182 17:61407146-61407168 CAGGTTGGGAGGAAGGAGGGAGG - Intronic
1150225041 17:63519892-63519914 GAGGCTGGGGGGCAGGAGGAGGG + Intronic
1150226692 17:63528298-63528320 CAGGAGTGGGTGAAGCAGGCAGG + Intronic
1150327593 17:64269281-64269303 CTGGAGTGGAGGCAGGAGGATGG - Intergenic
1150508572 17:65724876-65724898 CAGCCTTGGGGGCAGCAGGAGGG - Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150800955 17:68282352-68282374 TGGGGTTGGGGGAAGGGGGAGGG + Intronic
1150991395 17:70264033-70264055 CAGGAAGGGAGGAAGGAAGAAGG - Intergenic
1151106125 17:71618882-71618904 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151518713 17:74613652-74613674 AAGGAGTGGGGAAGGGAGGAGGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151676728 17:75602628-75602650 CAGAATTGGGGGACAGAGTATGG - Intergenic
1152032354 17:77851779-77851801 CAGGACAGTGGGCAGGAGGATGG - Intergenic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152088113 17:78232373-78232395 CAGTTTTGGGGGAAGACGGAGGG - Intronic
1152181583 17:78825525-78825547 CAGGATTGCTGGAAAGAGGAGGG - Intronic
1152204563 17:78967628-78967650 CAGGGCTGGAGGGAGGAGGATGG + Intergenic
1152253813 17:79225923-79225945 CAGTGGTGGGGGAAGCAGGATGG + Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152617111 17:81343071-81343093 CAGGAGTGGAGGAAGGTGGAAGG - Intergenic
1153316081 18:3723775-3723797 CAGGAATGGGGGAGGGTGTAAGG + Intronic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153597320 18:6740939-6740961 CTGGGTTCGGGGAAGCAGGAAGG + Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154465721 18:14641607-14641629 CAGGAATGGGGAAAAGAGGGTGG - Intergenic
1155231582 18:23779745-23779767 CAGGAATGTGGGTGGGAGGATGG + Intronic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155395818 18:25385787-25385809 CGGGGTTGGGGGAAAGGGGAGGG + Intergenic
1155563226 18:27103287-27103309 CAGGACTGGGGGCAGCAGCAAGG - Intronic
1156434996 18:37117493-37117515 TGGGATTGGGGGAGGGAGGAGGG + Intronic
1156498317 18:37540585-37540607 CAGCAGTGGGGCAGGGAGGAGGG + Intronic
1156843818 18:41639513-41639535 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1156857826 18:41803026-41803048 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156967586 18:43114027-43114049 TAGGATTTAAGGAAGGAGGAAGG - Intronic
1157182867 18:45512802-45512824 CTGGATTGGGGGGAGCTGGAAGG + Intronic
1157279944 18:46340237-46340259 GAGAATTGGGGGAAAGGGGAGGG + Intronic
1157297974 18:46459604-46459626 CATCTGTGGGGGAAGGAGGAGGG - Exonic
1157405495 18:47419277-47419299 GGAGATAGGGGGAAGGAGGAGGG + Intergenic
1157486317 18:48089974-48089996 CAGAACTGGGTGAAGGAGGTGGG + Intronic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157621023 18:49017574-49017596 CAGGTTTGGTGGAGGGAGCAGGG - Intergenic
1157686890 18:49650137-49650159 CAGGACTAGGGGAAGAGGGAAGG + Intergenic
1157967278 18:52222463-52222485 CAGCATTGGAGGATAGAGGATGG + Intergenic
1158048211 18:53182815-53182837 AAGGATGGCGGGAAGGAGGAAGG - Intronic
1158420560 18:57289243-57289265 CAGGCTTGAGGGTAGGAAGAAGG + Intergenic
1158996270 18:62923277-62923299 AAGGGTTGGGGGAATGAGAAGGG + Intronic
1159010666 18:63056580-63056602 AAGGATTGGGGGAGGTGGGAAGG - Intergenic
1159046918 18:63377597-63377619 AAGGAAGGGGGGAAGGAGGAAGG - Intergenic
1159055548 18:63459657-63459679 CAGGCATGGGGGTAGGAGGATGG + Intergenic
1159165247 18:64690663-64690685 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1159328384 18:66954096-66954118 TGGGATGGGGGGATGGAGGAGGG + Intergenic
1159689365 18:71466962-71466984 GAGGATTTGAGGAAGGAGCAGGG + Intergenic
1160231382 18:77052145-77052167 CAGGAACGGGGGAAGGAGCGGGG + Intronic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160544970 18:79647215-79647237 AAGGAAAGGGGGAGGGAGGAAGG + Intergenic
1160676403 19:393666-393688 AAGGATGGTGGGAAGGATGATGG + Intergenic
1160695236 19:480709-480731 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695263 19:480899-480921 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695275 19:480949-480971 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695287 19:481026-481048 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695303 19:481114-481136 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695318 19:481176-481198 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695357 19:481377-481399 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695406 19:481563-481585 AAGGATGGTGGGAAGGATGATGG + Intergenic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1161151990 19:2714467-2714489 CAGGATGGGGTGAAGGGTGAAGG - Intergenic
1161329214 19:3678417-3678439 AAGGATGGAGGGATGGAGGATGG + Intronic
1161329222 19:3678447-3678469 GAGGATGGAGGGATGGAGGATGG + Intronic
1161329228 19:3678462-3678484 GAGGATGGAGGGATGGAGGAGGG + Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162017170 19:7852038-7852060 CGGGGTTGGGGGCAGGAGGTGGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162540807 19:11294890-11294912 ATGGATTGGGGGAAGGCGGATGG - Intergenic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162824101 19:13241051-13241073 GAGGATTGGGGACAGCAGGATGG + Intronic
1162993360 19:14317749-14317771 TAAGATTTGGGGAAGGGGGATGG + Intergenic
1163115908 19:15188579-15188601 GAGGACTGGGGAGAGGAGGAGGG - Intronic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163755636 19:19104797-19104819 CAAGATTGGGGGGAAAAGGAGGG + Intronic
1163781252 19:19249876-19249898 GAGGACTGGGAGAAGGACGAAGG + Exonic
1163827843 19:19533547-19533569 CAGGAGGAGGGGGAGGAGGAGGG - Intronic
1163976439 19:20857480-20857502 TAGGGTGGGGGGATGGAGGAGGG + Intronic
1164550376 19:29206136-29206158 TCGGATTGGGGGTTGGAGGAAGG - Exonic
1164669682 19:30065304-30065326 CAGGTGTGGGGGGAGGAGGCAGG + Intergenic
1164806077 19:31118120-31118142 CAGGAAGGGAGAAAGGAGGATGG + Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165137030 19:33675954-33675976 CTGGATTGGGGAAAGGCAGATGG - Intronic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165331126 19:35141588-35141610 CAGGAGCGGGCGAAGGAGGGCGG - Intronic
1165432698 19:35781593-35781615 ACAGATTGGGGTAAGGAGGATGG + Intronic
1165564163 19:36709491-36709513 CTGGAGTGGGGGAAGGGGAAGGG - Intronic
1165817044 19:38648589-38648611 CAGGACTGGGGGTCTGAGGAGGG + Intronic
1166354280 19:42217729-42217751 GCGAGTTGGGGGAAGGAGGAGGG - Intronic
1166535131 19:43568765-43568787 CAGGAGTTGGGGAGGGAGCAGGG + Intronic
1166781271 19:45344929-45344951 TAGGTTGGGGGGAATGAGGATGG - Intronic
1166810148 19:45509414-45509436 CAGGCTCGGTGGAAGGCGGATGG + Intronic
1166979292 19:46623414-46623436 GAGGAGTGGGGAGAGGAGGAGGG - Intronic
1166981887 19:46635852-46635874 GAGGAAGGGGGGAGGGAGGAAGG + Intergenic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167126175 19:47550279-47550301 CAGGAAGGAAGGAAGGAGGAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1167574279 19:50310292-50310314 CAGAAATGGGGGAAGGAGAGTGG - Exonic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167699407 19:51033737-51033759 CAGGAATGGGAGAGGCAGGAGGG + Intronic
1168109203 19:54182063-54182085 AAGGACGGAGGGAAGGAGGAAGG + Intronic
1168161417 19:54512872-54512894 GGGGATTGGTGGAAAGAGGATGG + Intergenic
1168469660 19:56629955-56629977 CAGGCTCGGGGCAGGGAGGATGG - Intergenic
1168651011 19:58092106-58092128 GGGGTTTGGGGGAATGAGGAGGG + Intronic
1202692666 1_KI270712v1_random:102355-102377 CGGCATTGGGGGACGGAGGTGGG - Intergenic
925169742 2:1743640-1743662 AAGGAAGGGGGGGAGGAGGAGGG + Intronic
925184649 2:1838775-1838797 CGTCATTGGGGGAAAGAGGATGG - Intronic
925372358 2:3356025-3356047 CATGTTGGGGTGAAGGAGGAAGG + Intronic
925833069 2:7915404-7915426 GGGGAGTGGAGGAAGGAGGATGG - Intergenic
925908099 2:8551558-8551580 CAGGATTTGGGTAAGAAGAATGG - Intergenic
925947220 2:8876705-8876727 AAGGAAAGGGGGAAGGGGGAAGG + Intronic
925976645 2:9146545-9146567 CAGGTTTTGGGGAACTAGGATGG - Intergenic
926010045 2:9400288-9400310 CAGGAGTGGGGGAGGAAGGAAGG - Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926188348 2:10708883-10708905 CAGGCATGGGGGATGGAGGTGGG + Intergenic
926266861 2:11330936-11330958 GAGGAAGGGGGGAGGGAGGAGGG + Intronic
926422673 2:12715522-12715544 CAGGTTTGTGGGGAGTAGGATGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926845358 2:17131022-17131044 CAGGATGGGGGAATGGGGGAGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
926995631 2:18732434-18732456 AAGGATTGGGGGATGGGAGAGGG + Intergenic
927445775 2:23160315-23160337 CAGACTTGGGGGCAGGAGAAAGG + Intergenic
927714256 2:25342047-25342069 CCGGAGGGAGGGAAGGAGGAAGG - Intronic
927840859 2:26442630-26442652 CAGGATTGGGGATATGAGGTTGG - Intronic
927856153 2:26529128-26529150 CAAGCATGAGGGAAGGAGGATGG + Intronic
927962413 2:27249348-27249370 CAGGATGGGGGAAAGCAGGGAGG + Intergenic
928166161 2:28973499-28973521 CAGGAAGGAGGGAAGGAGGGAGG - Intronic
928313822 2:30231448-30231470 CAGGAGTGGGCGAGGGAGGGCGG + Intergenic
928511390 2:32007261-32007283 CAGGTTTGGAGCAGGGAGGAAGG - Intronic
928535190 2:32233119-32233141 GAGGGGTGGGGGAGGGAGGAAGG + Intronic
928649945 2:33393432-33393454 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
929190623 2:39136171-39136193 CAGGATTTGGGTAAGGAATAGGG - Intergenic
930320723 2:49851960-49851982 CAAGATTGAGGGCAGGATGAGGG - Intergenic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930395218 2:50814381-50814403 CAGGGTTTGGGGAATGAGAAGGG - Intronic
930451792 2:51550294-51550316 TAGGATTGGGGGAGAGGGGAGGG - Intergenic
930452161 2:51555771-51555793 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931014671 2:57962563-57962585 GAGGATGGAGGGAGGGAGGAGGG - Intronic
931316608 2:61139036-61139058 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
931427694 2:62185930-62185952 CAGGATAGGGTGGAGGGGGAGGG - Intergenic
931493185 2:62772167-62772189 GAGGAAGGGGGAAAGGAGGAAGG + Intronic
931695654 2:64868733-64868755 CGGAAATGAGGGAAGGAGGAAGG + Intergenic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
932431284 2:71675139-71675161 AGGGATTGGGGGAGGGGGGATGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932780724 2:74556836-74556858 CAAGCTCGGGTGAAGGAGGAGGG + Exonic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933823917 2:86141231-86141253 AAGGATGGGGGCAGGGAGGAGGG - Exonic
933953736 2:87351609-87351631 CGGCATTGGGGGACGGAGGTGGG + Intergenic
934237941 2:90247863-90247885 CGGCATTGGGGGACGGAGGTGGG + Intergenic
934275261 2:91568874-91568896 CGGCATTGGGGGATGGAGGTGGG - Intergenic
934322070 2:91980413-91980435 CGGCATTGGGGGACGGAGGTGGG + Intergenic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
934716467 2:96547454-96547476 CAGGTTTGGGGGATGCAGGTGGG - Exonic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935057191 2:99577839-99577861 TAGAATTGGGTGAAGGATGATGG + Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935369908 2:102334303-102334325 GAGGATTGGGTGAAGCAAGAAGG + Intronic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
935686310 2:105687098-105687120 TGGGGTTGGGGGATGGAGGAGGG + Intergenic
936487387 2:112937960-112937982 AAGGAGTGGGTGATGGAGGAAGG + Intergenic
936839121 2:116748637-116748659 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
937122586 2:119451285-119451307 CAGCATAGGGGGACAGAGGAGGG - Intronic
937279258 2:120706042-120706064 CAGGCTTGGAGGAAGGAGCCCGG - Intergenic
937389055 2:121466962-121466984 CAGGGTTTGGGGTGGGAGGAGGG - Intronic
937856658 2:126676932-126676954 CAGGATTGGAGGACAAAGGAGGG + Intronic
937912029 2:127080419-127080441 CAGGAGTTGGGTGAGGAGGAGGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937996610 2:127698981-127699003 CAGGTTTTGGGGGATGAGGAGGG + Intergenic
938078851 2:128358483-128358505 CAGCAATGGGGAAAGGAGAAAGG - Intergenic
938125786 2:128670514-128670536 CAGGGATGGGGGCAGGAGAAGGG - Intergenic
938549695 2:132368846-132368868 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
938942714 2:136182855-136182877 AAGGGTTGGGGGAAAGAGGAGGG + Intergenic
939547273 2:143569013-143569035 TAGGATGGGGGGCAGGGGGAGGG + Intronic
939647545 2:144719635-144719657 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
939650635 2:144757876-144757898 CAGGGTGTGGGGAAGAAGGAGGG - Intergenic
939833040 2:147095479-147095501 AGGGAATGTGGGAAGGAGGATGG + Intergenic
939949688 2:148455282-148455304 CAGGGTTTGGGGATGGAGTATGG - Intronic
940069657 2:149671656-149671678 CAGGGTTGGGGGCTAGAGGAGGG - Intergenic
940115484 2:150204076-150204098 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
940248094 2:151641954-151641976 TAGGATGGGGGGAGGGAGGAGGG - Intronic
940317749 2:152342659-152342681 CAGGTTTCTGGAAAGGAGGAAGG - Intronic
940383008 2:153037300-153037322 AAGGACTGGGGGAGGTAGGAGGG - Intergenic
940479703 2:154212700-154212722 AAGGATGGGGGGAAGAAGGAGGG - Intronic
940643895 2:156370404-156370426 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
940723698 2:157309965-157309987 CAGGAGGGAGGGAAGGAGAAAGG + Intronic
941282287 2:163567934-163567956 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
941373000 2:164691074-164691096 CAGGAGTGGAGGAAACAGGAGGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941515582 2:166472104-166472126 AAGGAGTGGGGGGAGGGGGAGGG - Intronic
941538661 2:166754780-166754802 CAGGGATGGGGGATGGGGGAGGG - Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942414191 2:175741237-175741259 AAGGAAGGAGGGAAGGAGGAGGG + Intergenic
942415210 2:175751654-175751676 CAGGCTTGAGGGAAGGAGACAGG - Intergenic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
942461453 2:176171401-176171423 CAGGATTGGAGGTGGGGGGAGGG + Intronic
942534850 2:176952085-176952107 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
942570914 2:177313413-177313435 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
942609534 2:177728370-177728392 CAGGGTTGGGGGCGGGGGGAGGG + Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
943507908 2:188785133-188785155 GAGGGTTGGGGGTGGGAGGAGGG + Intronic
944177636 2:196850642-196850664 AAGGAAGGAGGGAAGGAGGAAGG + Intronic
944192736 2:197020939-197020961 TGGGATGGGGGGAGGGAGGAGGG - Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944412393 2:199457548-199457570 GATGATGGGGGGAGGGAGGAGGG + Exonic
944452568 2:199857772-199857794 AAGATTTGGGGGAAGGAGGAAGG + Intergenic
944879410 2:203996129-203996151 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
945025563 2:205616611-205616633 CTGGAATGTGGGAGGGAGGAAGG - Intronic
945346481 2:208724168-208724190 TGGGATGGGGGGAAGGGGGAGGG - Intronic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945722047 2:213429358-213429380 CAGCATTGTGGGAAGGTGGTGGG - Intronic
946229558 2:218282989-218283011 CAGGGTGGGGGTAAGGGGGAGGG - Intronic
946335851 2:219036031-219036053 CAGGACTGGGAGGAGGAAGAGGG - Intronic
946337251 2:219046181-219046203 GAAGGTTGGAGGAAGGAGGAAGG - Intergenic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946588250 2:221215083-221215105 TAGGGTTGGGGGAAGGGAGAAGG - Intergenic
947077715 2:226363915-226363937 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947245693 2:228045598-228045620 CGGGATTGGGGGAGCGGGGAGGG + Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947459462 2:230290671-230290693 TTGGCTTGAGGGAAGGAGGAAGG + Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947650375 2:231781283-231781305 GAGGCTAGGGGGAAGGAGAAGGG - Exonic
947855576 2:233321594-233321616 CAGGCTGGGGGGTTGGAGGATGG + Intronic
947895388 2:233666790-233666812 TGGGATTGGGGGAGGGGGGAGGG - Intronic
947910480 2:233797725-233797747 GAGGGTTGGGGGAAAGGGGAGGG - Intronic
948034662 2:234848209-234848231 CAGGTTGGGGAAAAGGAGGAGGG + Intergenic
948057486 2:235019351-235019373 CTGGATTGGGGGCAGAAGAAAGG + Intronic
948106874 2:235421549-235421571 CAGGTTAGGGGGAGGAAGGAGGG - Intergenic
948283983 2:236769837-236769859 GAGCAGTGGGGGGAGGAGGATGG - Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948771771 2:240254951-240254973 AAGGACTAGGGGAAGAAGGATGG - Intergenic
948958257 2:241312055-241312077 CATGATTAGGGGAAGGATGTTGG + Intronic
1168894446 20:1313573-1313595 TAGGGATGGGGAAAGGAGGATGG + Intronic
1169000491 20:2164517-2164539 CACATTTGGGGGAAGCAGGAAGG - Intronic
1169148516 20:3270635-3270657 CATGATTAGGGGATGGAGCAAGG - Intronic
1169197106 20:3689267-3689289 GAGGAATGGGGGCAGGAGGTGGG - Intronic
1169438429 20:5613695-5613717 AAGGATTTAGGGAAGGAGCATGG - Intergenic
1169537819 20:6564766-6564788 GAGGAATGGGAGAAGCAGGATGG - Intergenic
1169656870 20:7934008-7934030 TTGGTTTGGGGGAAGCAGGAGGG + Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170695042 20:18650407-18650429 CAGGATGTGGGCAGGGAGGACGG - Intronic
1170742027 20:19066610-19066632 CAGGGGTGGGGGAAGGGGGATGG - Intergenic
1170796637 20:19553026-19553048 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1171202663 20:23254627-23254649 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1171255802 20:23688311-23688333 CATGACTTGGGGAAGGAAGAAGG + Intronic
1171510843 20:25683358-25683380 GGGAAATGGGGGAAGGAGGAAGG + Intronic
1171862464 20:30413165-30413187 CAGGAAGGAGGGAAGGAAGAAGG + Intergenic
1171883681 20:30636167-30636189 GAGGGTGGGGGGAAGTAGGAAGG - Intergenic
1172037570 20:32020530-32020552 CAGGTTTTGGGGGAGGAGGTTGG - Intronic
1172244053 20:33433662-33433684 CAGGCCTGGGGGAAGAGGGAGGG - Intronic
1172253502 20:33496809-33496831 CAGGATAGGGTGAAAAAGGATGG - Intronic
1172309780 20:33908635-33908657 CAGGAGTGGGGGAAGAAGATAGG - Intergenic
1172939683 20:38645876-38645898 CTGGTTTGGTGGAATGAGGAGGG - Intronic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173575958 20:44113100-44113122 CAGGGTGGGAGGAAGGGGGATGG + Exonic
1174060280 20:47827488-47827510 CAGGAGTGGAGCAAGGAGGATGG - Intergenic
1174071617 20:47903882-47903904 CAGGAGTGGAGCAAGGAGGATGG + Intergenic
1174152432 20:48494753-48494775 CAGGAGTGGAGCAAGGAGGATGG - Intergenic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1174604470 20:51750901-51750923 CAGGCTTGGAGGGAGGAGGCAGG - Intronic
1175059626 20:56230355-56230377 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175145779 20:56895214-56895236 GGGGGTTGGGGGAAAGAGGAGGG - Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175240581 20:57545248-57545270 GAGGAGGGGGGTAAGGAGGAAGG + Intergenic
1175293685 20:57894701-57894723 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175461416 20:59154475-59154497 CAGGATGGGAGGAAAGTGGAAGG - Intergenic
1175497290 20:59423732-59423754 CGAGACTGGGGGAGGGAGGAGGG - Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1175776935 20:61659558-61659580 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175776946 20:61659597-61659619 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175776957 20:61659636-61659658 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175776967 20:61659675-61659697 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175776979 20:61659714-61659736 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175776990 20:61659753-61659775 GAGGCTTGGAGGCAGGAGGAGGG + Intronic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175783024 20:61695786-61695808 AAGGATTGGACGAAGGAGGTTGG - Intronic
1175843967 20:62049027-62049049 GAGGACTGGGGGAGGGGGGATGG - Intronic
1176162182 20:63653523-63653545 GAGGGTTGGGGGAAGGAGCGGGG + Intergenic
1176308323 21:5135967-5135989 CAGGATGCTGGGCAGGAGGATGG - Exonic
1176808868 21:13516983-13517005 CAGGAATGGGGAAAAGAGGGTGG + Intergenic
1176843387 21:13858255-13858277 GAGGGTTGGGGGTAGTAGGAAGG - Intergenic
1176996077 21:15556730-15556752 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
1177363871 21:20108525-20108547 CAGGATTGAGTGAACAAGGATGG + Intergenic
1178163954 21:29950308-29950330 AAGGATGGGGGGAAGAGGGAAGG - Intergenic
1179116702 21:38499828-38499850 GAGGATGGGAGGAAGGAGGGAGG + Intronic
1179215916 21:39366937-39366959 GGGGAAAGGGGGAAGGAGGAGGG - Intergenic
1179264636 21:39792379-39792401 TAGGGTGGGGGGAAGGGGGAAGG + Intronic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179609557 21:42541054-42541076 CAGGGTTGGGGAGAGGAGGATGG + Intronic
1179848737 21:44126065-44126087 CAGGATGCTGGGCAGGAGGATGG + Exonic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1180059101 21:45375533-45375555 CAGGCTGGGGGGATGGAGGAGGG + Intergenic
1180235623 21:46458031-46458053 CAGGACTGGGCGGAGGAAGAAGG + Intergenic
1180548817 22:16526329-16526351 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1180572367 22:16738700-16738722 CATGAATGGGGAAAGAAGGAAGG - Intergenic
1180989780 22:19928561-19928583 CAGAAGTGGGGGAAGCCGGAAGG + Intronic
1181085962 22:20439465-20439487 CAGGTCTGGGGGAAGGAGAAAGG - Intronic
1181106318 22:20577841-20577863 CAGGATTTATGGAAAGAGGAAGG + Intronic
1181173624 22:21023790-21023812 CAGGACTTGGGGCAGCAGGACGG - Intronic
1181335019 22:22123010-22123032 CAGGAGTGGGGAAAAGAGGTTGG - Intergenic
1181355895 22:22295557-22295579 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1181542209 22:23579600-23579622 GAGGAGTGGGAGGAGGAGGAGGG + Intronic
1181850844 22:25748911-25748933 CAGGCTTGGGTGAAGTAGGCTGG + Intronic
1181963267 22:26638346-26638368 AAGGAGTGGAGGAAGGAGGGAGG + Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1182904120 22:33921308-33921330 CGGGGTTGGGGGAAGAAGGGCGG - Intronic
1183105149 22:35610219-35610241 CAGGGTTGGGGGCAGGAGCCTGG - Intronic
1183214735 22:36472268-36472290 CAGGCCTGGAGGGAGGAGGAAGG + Intronic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183259429 22:36784945-36784967 CAGGGTTGGAGGTAGGAGGAAGG - Intergenic
1183371236 22:37433673-37433695 CGGGGTTGGGGGGAGGGGGATGG - Intergenic
1183383722 22:37503276-37503298 CTGGTGTGGGGGCAGGAGGAGGG - Intronic
1183453809 22:37910728-37910750 AAGTGTTGGGGGCAGGAGGAGGG + Intronic
1183463826 22:37968926-37968948 CAGGCTTGGAGGAGGGTGGATGG - Exonic
1183474161 22:38026781-38026803 AGGGATGGGGGGAGGGAGGAGGG - Intronic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183641001 22:39092332-39092354 CAGGATGGGAGGAAGGAGACTGG - Intergenic
1183698796 22:39438158-39438180 AGGGATGGAGGGAAGGAGGAAGG - Intergenic
1183779677 22:39990729-39990751 CAGATTTGGGGAAAGGGGGATGG + Intergenic
1183854700 22:40623462-40623484 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
1184231871 22:43162776-43162798 AGAGATTGGGGGACGGAGGATGG - Intronic
1184239924 22:43206626-43206648 AAGGATGGGGGGAAAGAGGTGGG + Intronic
1184376937 22:44119465-44119487 CAGGATGGGAGGCAGCAGGAGGG + Intronic
1184451630 22:44586064-44586086 CAGGATGGAGGGAGGGAGAATGG - Intergenic
1184482068 22:44753589-44753611 CAGGATTGAGGGAAAGTGAAAGG - Intronic
1184538742 22:45105806-45105828 CTGGAGTGGAGGCAGGAGGAGGG + Intergenic
1184629810 22:45767694-45767716 GAGGGTTGGAGGAAGGAAGAAGG + Intronic
1184686064 22:46096890-46096912 CCTGAGTGGGGGTAGGAGGAAGG - Intronic
1185116003 22:48938623-48938645 GAGAAGTGAGGGAAGGAGGAAGG - Intergenic
1185261778 22:49869964-49869986 GAGGAGTGAGGGAGGGAGGAAGG - Intronic
1185370507 22:50458830-50458852 CTGGATTGGGGGATGCAGGGAGG + Intronic
949111929 3:271164-271186 AAGGATTGTGGGGAGGGGGAAGG + Intronic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
949586894 3:5449557-5449579 CAGATTTGGGGGAAGGGGGTGGG + Intergenic
949958685 3:9292794-9292816 CAGTAATGGGGGGAGAAGGAAGG - Intronic
950037779 3:9899533-9899555 CAGCAGGGAGGGAAGGAGGAAGG - Intergenic
950092783 3:10308238-10308260 CACGATTGGGGGCTGCAGGATGG - Intronic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950478958 3:13232964-13232986 CGGGGCTGGGGGAGGGAGGATGG + Intergenic
950565459 3:13767289-13767311 CGGGATTAGAGGAAGCAGGAGGG - Intergenic
950728950 3:14939418-14939440 CAGGATGGAGGGAGGTAGGAGGG + Intergenic
950962841 3:17123488-17123510 CAGGAGTGGGGAAGGGAGTAGGG + Intergenic
951045955 3:18038679-18038701 CAGGCTTGTGGGAATGAGCATGG + Intronic
951820464 3:26804439-26804461 TGGGATGGGGGGAGGGAGGAGGG + Intergenic
951923906 3:27886494-27886516 CAGGGGTGGGGGCAGGAGGGAGG - Intergenic
952019412 3:28998910-28998932 TGGGATGGGGGGAAGGAGAAGGG + Intergenic
952067797 3:29593008-29593030 TGGGATTGGGGGAGGGGGGAGGG + Intronic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952501310 3:33964830-33964852 TAGGATTGGGGGACGGGGAAGGG - Intergenic
952858778 3:37795002-37795024 CAGGTGTGGGGGAGGGAGGAGGG - Intronic
952870040 3:37890837-37890859 CAGGAAGGGAGGAAAGAGGAAGG + Intronic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
953564639 3:44021402-44021424 GAGGAAGGGGGGAAGGAAGAGGG - Intergenic
953565397 3:44027847-44027869 CAGGACTGGGGACAGGAGAATGG - Intergenic
953677875 3:45017386-45017408 CAAGGTTGTGGGAAGGAGGAGGG - Intronic
954155961 3:48685172-48685194 CGGGGTTGGGGGAAGAAGGAAGG + Intronic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954503482 3:51044429-51044451 GAGGATGGAGGGTAGGAGGAGGG + Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955305088 3:57822599-57822621 CAGGATTGAGGGATGGGAGATGG - Intronic
955537751 3:59942330-59942352 CAGGAGTGTGGGGAGGAGGAAGG - Intronic
955570191 3:60296213-60296235 GGGGAAGGGGGGAAGGAGGAGGG + Intronic
956084735 3:65597507-65597529 CAGGCTGGGAGGAAGGGGGAGGG - Intronic
956513672 3:70022273-70022295 CCGGGTGGGGGGAGGGAGGAGGG + Intergenic
956618637 3:71198409-71198431 CAAGATGGGGGGAGGGAGGGGGG + Intronic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956796346 3:72722130-72722152 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957550197 3:81694466-81694488 CAAGAGTGGGCAAAGGAGGAGGG + Intronic
957893478 3:86389305-86389327 GAGGATTAGGGGAGAGAGGAAGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958254365 3:91308178-91308200 GAGGAGTGGGGGAAGGAGAAGGG + Intergenic
958607357 3:96376155-96376177 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
958822622 3:98993041-98993063 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
959071017 3:101702049-101702071 CCAGCTTGGGGGAAGGAGGAGGG + Intergenic
959168732 3:102817086-102817108 CAGGATTTAGGGGAGAAGGAAGG - Intergenic
959368771 3:105496438-105496460 AAGGATGGAGGGAAAGAGGAAGG + Intronic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959901415 3:111665860-111665882 CAGGAGCGGGGGCAGGAAGAAGG + Intergenic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960255427 3:115506176-115506198 CAGGAAGGGGGGAATGTGGAGGG + Intergenic
960311380 3:116120408-116120430 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
960334096 3:116394715-116394737 CAGGAATGGGGCAAGGAGTTGGG - Intronic
960337663 3:116437640-116437662 AAGAATTGGAGGGAGGAGGAAGG + Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961202831 3:125057858-125057880 GAGGATTGGGGGGAGGTGGCAGG - Intergenic
961448822 3:126993296-126993318 AAGGAATGGGGGCAGGAAGAAGG - Intronic
961508730 3:127388462-127388484 CAGGCTGGGGGGTAGAAGGAAGG - Intergenic
961691682 3:128674630-128674652 TAGGAATGGGGGACAGAGGAAGG - Intronic
961926402 3:130486388-130486410 TGGGATGGGGGGAAGGGGGAGGG - Intergenic
962090889 3:132243003-132243025 CAGGATACGGGGTAGGAGGAGGG - Intronic
962168486 3:133076071-133076093 CGAGATTTGGGTAAGGAGGAAGG + Intronic
962228639 3:133639448-133639470 TAGGATGGGGGGATGGGGGAGGG + Intronic
962354850 3:134684978-134685000 CCTGATTGGAGGAAGGAAGAAGG + Intronic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
962639404 3:137369315-137369337 CGGGGTTGCGGGAAGGGGGAGGG - Intergenic
962876222 3:139538056-139538078 CAGCAGTGGGGGAAGAGGGAGGG - Intronic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
963025338 3:140913570-140913592 CAGGGTTGGGGGTTGGAGGTGGG - Intergenic
963287549 3:143448005-143448027 AAAGAATGGGGGATGGAGGATGG + Intronic
963311710 3:143716935-143716957 CAGGGATGGGCAAAGGAGGAAGG + Intronic
963313438 3:143733348-143733370 AAGAAATGGGGGTAGGAGGAGGG + Intronic
963584323 3:147165042-147165064 GAGGGTGGGGGGTAGGAGGATGG + Intergenic
963811851 3:149785401-149785423 TGGGGTTGGGGGAAGGGGGAAGG - Intronic
963812797 3:149795994-149796016 CAGGATTGGGGGACAGGTGAAGG - Intronic
963831694 3:150015780-150015802 AAGGATTGGGGGAAGTATGCTGG + Intronic
964410449 3:156392110-156392132 CAGGAGTAGGGGTAGGAGAATGG - Intronic
964458667 3:156897047-156897069 GAGGATAGAGGGTAGGAGGAAGG + Intronic
964903855 3:161693985-161694007 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
964923811 3:161931947-161931969 TAGGGTCGGGGGAAGGGGGAGGG - Intergenic
964934897 3:162072185-162072207 CAGGATGGGGGGCAGGAAAAGGG + Intergenic
965343578 3:167519633-167519655 CAGGGGTGGGGGATGGGGGAGGG + Intronic
965554123 3:170002116-170002138 CAGAATCCGGGGAAGGAGCAAGG + Intergenic
965937051 3:174127508-174127530 CAGGAATATGGGAAGAAGGAGGG - Intronic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966233703 3:177676881-177676903 CAGGAGTGGGGAGTGGAGGAGGG - Intergenic
966280365 3:178219630-178219652 CAGGGTTGGGGGCAAGGGGAGGG - Intergenic
966384543 3:179382212-179382234 TGGGATGGGAGGAAGGAGGAGGG - Intronic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966559197 3:181300102-181300124 GAGGAGTAGGGGAAGGAGAAGGG + Intergenic
966661564 3:182420213-182420235 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
966711876 3:182980303-182980325 CGGGAAGGGGCGAAGGAGGAAGG + Intronic
967261727 3:187649155-187649177 CAGGATTTAGGAAAGGACGATGG + Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967359444 3:188612888-188612910 CAGGATGGGGAAAAGGAGAAAGG + Intronic
967429570 3:189366174-189366196 CAGGGGTGGGGGTAGGAGGAAGG - Intergenic
968530151 4:1087078-1087100 CAGGAGTGGGGGTGAGAGGACGG + Intronic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
968942839 4:3648047-3648069 CAGGGTAGGGGCAAGAAGGATGG - Intergenic
969270306 4:6095077-6095099 GGGGAGTGGGGGAGGGAGGAAGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969551269 4:7869211-7869233 ATGGATGGAGGGAAGGAGGAAGG + Intronic
969849739 4:9946976-9946998 CAGGCTTGGAGGAAGGGGTATGG - Intronic
969855564 4:9996473-9996495 CAGGATGGAGGGTGGGAGGAGGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970410591 4:15803794-15803816 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
970480635 4:16469680-16469702 GAGGATTGGGGATGGGAGGAGGG + Intergenic
970553666 4:17209751-17209773 AAGGGTTGGGGGTGGGAGGAGGG + Intergenic
970775832 4:19672854-19672876 AAGGGTTGGGGGAAGGGGGAAGG + Intergenic
970837000 4:20421173-20421195 AAGGATTTGGTGAAGGATGAGGG + Intronic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
971234170 4:24826438-24826460 CAGGAATGGGGCAATGAGGAGGG + Intronic
971278403 4:25220096-25220118 CAGGATTGGTGGAAACAGCAAGG - Intronic
971605790 4:28655327-28655349 CATGATTGTGGGAAAGAGGTGGG + Intergenic
971661693 4:29426093-29426115 AAGGATTGGAGGAAGGATGGAGG - Intergenic
971843169 4:31881027-31881049 AAGGAGGGAGGGAAGGAGGAGGG - Intergenic
971904644 4:32710687-32710709 GGGGGTTGGGGGAGGGAGGAGGG + Intergenic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
973326182 4:48864720-48864742 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
973367337 4:49218438-49218460 GAGGGTGGGGGGAAGTAGGAAGG - Intergenic
973546101 4:51983505-51983527 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
973563206 4:52157458-52157480 TAGGTTTGGGGGCAAGAGGAGGG + Intergenic
973822894 4:54678365-54678387 AGGGATTGGGGGAGGGAGGGAGG - Intronic
974093675 4:57339024-57339046 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974433328 4:61826767-61826789 CAGGGTTGGGGGAGAGGGGAGGG + Intronic
974696610 4:65383784-65383806 AGGGGTTGGGGGAAGTAGGAAGG + Intronic
974715800 4:65668722-65668744 CAGGATTGGGGGTAGGGAGGGGG + Intronic
974966556 4:68768350-68768372 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975050667 4:69860378-69860400 CAGGGGTTGGGGAAGAAGGAGGG + Intergenic
975359202 4:73447280-73447302 GAGGGATGGAGGAAGGAGGAAGG - Intronic
975431627 4:74298473-74298495 GAGGTTTGGGTGGAGGAGGAGGG - Intronic
975803663 4:78089901-78089923 AAGGATGGAGGGTAGGAGGAGGG - Intronic
976448191 4:85156098-85156120 CAGGAAAGGAGGAAGAAGGAAGG + Intergenic
976737287 4:88323515-88323537 AAGGATTGTGGGAAGGGGAAGGG + Intergenic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
977158771 4:93608452-93608474 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
977191358 4:94004669-94004691 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
977428716 4:96903422-96903444 TGGGATTGGGGGATGGGGGAGGG + Intergenic
977621521 4:99142830-99142852 CAGGGTTGGGGGTAGGAGAGAGG + Intronic
977624050 4:99170965-99170987 TAGGATGGGGGGAGGGGGGAGGG - Intergenic
977959192 4:103066076-103066098 CACCATTGTGGGAAGGGGGAAGG - Intronic
978739215 4:112118935-112118957 AAGGGATGGGGGAAGGGGGAAGG + Intergenic
978762779 4:112372768-112372790 CAGGATGGGGGGAATTAGGGAGG - Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979045064 4:115852275-115852297 CAGGATGGTGGGCAGGGGGAGGG - Intergenic
979111253 4:116761085-116761107 CAGGAGAGGTGGAAGGAGTAGGG - Intergenic
979373810 4:119920478-119920500 CAGGAGTGGGGGTGAGAGGATGG + Intergenic
979552924 4:122011252-122011274 CAGGATTGGAGGATGGAATAGGG + Intergenic
980173156 4:129313452-129313474 CAGGATTCTGGGCAGGAAGAGGG - Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980891360 4:138818736-138818758 GAGGAGCGGGGGAAGGAGGAAGG + Intergenic
981012934 4:139944320-139944342 TGGGATGGGGGGAAGGGGGAGGG - Intronic
981391871 4:144200308-144200330 CAGGGTTGGGGGCAGGGAGAGGG + Intergenic
981392655 4:144209828-144209850 CAGGGTTGAGGGAAAGAGAAAGG + Intergenic
981607243 4:146553074-146553096 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
981672630 4:147304648-147304670 CAGGATTGGGGGCTCCAGGAAGG - Intergenic
982183617 4:152774039-152774061 AGGGATTGGGAGAGGGAGGAAGG - Intronic
982195670 4:152910287-152910309 CAGAGTTGGGGGAAGTGGGAGGG + Exonic
982288588 4:153759099-153759121 GAGGATTTGGGGGTGGAGGAGGG - Intronic
982460380 4:155662936-155662958 CAGGGTGGGGGGATGGGGGAGGG - Intergenic
982545950 4:156733534-156733556 CAGGATTGGGGATAGCAGGGGGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983107645 4:163709209-163709231 CGGGATTGAGGGAAGCAGGCAGG + Intronic
983112759 4:163773219-163773241 CAGAAATGGGGAGAGGAGGAAGG + Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
984414267 4:179436386-179436408 CAGAATTGTGGGAAGAAGTAAGG + Intergenic
984803312 4:183733845-183733867 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
984948184 4:184986281-184986303 CAGACCTGGGGGAAGAAGGAAGG - Intergenic
985212583 4:187611197-187611219 AAGCATTGGAGGAAGCAGGAAGG + Intergenic
985235812 4:187872812-187872834 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
985381316 4:189398128-189398150 CATGATTTGGGGAGTGAGGATGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985511854 5:317954-317976 CAGGGTTGGGAGTAGGTGGAGGG - Intronic
985588931 5:754942-754964 CAGGCTTGGGGGAATTTGGAAGG - Intronic
985603611 5:847458-847480 CAGGCTTGGGGGAATTTGGAAGG - Intronic
985653043 5:1115834-1115856 GAGAATCGGGGGAAGGGGGAGGG + Intergenic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
985700797 5:1371229-1371251 CAGAATTGGGGAACTGAGGAGGG - Intergenic
985850536 5:2385437-2385459 CAGGATTGGGGCATGGGGTATGG - Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
985950783 5:3220125-3220147 AATGGTTGGGGGATGGAGGAGGG - Intergenic
986264520 5:6180899-6180921 CAAGATGGAGGGAAAGAGGAGGG - Intergenic
986362435 5:6993208-6993230 AAGGAGCGGGGGAGGGAGGAAGG - Intergenic
986421552 5:7589536-7589558 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987097009 5:14559100-14559122 CTGGCTTGGGGGAAGGAGAGGGG + Intergenic
987287860 5:16476754-16476776 TAGGGTTGGGGGTGGGAGGAGGG + Intronic
987549014 5:19353820-19353842 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
988209471 5:28184669-28184691 TGGGATGGGGGGAAGGGGGAGGG - Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988730616 5:33969438-33969460 CAGGATTAGAGGTAGGTGGATGG - Intronic
988850281 5:35173973-35173995 TGGGGTGGGGGGAAGGAGGAGGG - Intronic
989408485 5:41089790-41089812 GGGGATTAGGGGAAGGAGAAGGG - Intergenic
990238133 5:53789814-53789836 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
990623753 5:57588695-57588717 TGGGATGGGGGGAAGGGGGAGGG + Intergenic
990640706 5:57780589-57780611 AAGGAATAGGGGAAGGAAGAGGG - Intergenic
991110069 5:62889663-62889685 CTAGATTTGGGGAAGGAGGGTGG + Intergenic
991250114 5:64550721-64550743 CAGGGTTGGGGGAGGGGGGAGGG - Intronic
991337596 5:65566395-65566417 TAGGATTGAGGAAAGGAAGAAGG + Intronic
991337887 5:65570726-65570748 CATGGTTGGAGGAAGAAGGAAGG + Intronic
991405423 5:66296486-66296508 CAGGAGTTGGGGAGGAAGGAAGG - Intergenic
991987870 5:72308406-72308428 GCTGATTGGGGGACGGAGGAGGG - Intronic
992357298 5:75999348-75999370 AAGGAGTGGGGGAGGGAGGGAGG + Intergenic
992411695 5:76511360-76511382 AAGGAGTGGGGGAAGAAGAAGGG + Intronic
992427520 5:76672905-76672927 TGGGATTGGGGGAGGGGGGAGGG + Intronic
992483274 5:77171920-77171942 CAGGATGAGGGGAGGAAGGATGG + Intergenic
992770582 5:80043592-80043614 CAGGACTGGGAGATGAAGGAGGG + Intronic
992971817 5:82068398-82068420 TAGGATTGGGGGAGAGGGGAAGG + Intronic
993111600 5:83663632-83663654 CAGATTTGGGCGAGGGAGGAGGG - Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993375362 5:87144006-87144028 CAGGAGTGGGGCTAGGGGGAGGG - Intergenic
993552275 5:89288510-89288532 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
993611484 5:90059779-90059801 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
993816088 5:92547148-92547170 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
993999909 5:94766522-94766544 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
994034952 5:95187717-95187739 AGGGATTGGGGGTAGGGGGAAGG + Intronic
994262744 5:97679406-97679428 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
994291012 5:98028901-98028923 CGGGATTGGGGGAGGGGGAAGGG + Intergenic
994535263 5:101022311-101022333 CGGGGTTGGGGGAGGCAGGAGGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
995016804 5:107318919-107318941 GAGGAAGGGAGGAAGGAGGATGG + Intergenic
995279619 5:110318349-110318371 CGGGGTTGGGGGAGGGGGGAGGG + Intronic
995324531 5:110875370-110875392 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995460305 5:112396099-112396121 TGGGGTTGGGGGAAGGGGGAGGG + Intronic
995677317 5:114676738-114676760 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
995931415 5:117450800-117450822 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
996365559 5:122696908-122696930 GAGAAGTGGGGGAAGAAGGAAGG + Intergenic
996623721 5:125542741-125542763 TAGGAATGGTGGAAGGAGGTGGG - Intergenic
996661106 5:126003756-126003778 CAGGTTTTGGGGGAGGAGGAGGG - Intergenic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997049230 5:130358913-130358935 GAGGGTTGGGGGTGGGAGGAAGG + Intergenic
997357609 5:133273836-133273858 CATGCTTGGGGGAAGGACGGTGG - Intronic
997823415 5:137085870-137085892 CACTATTGGGGCAGGGAGGAAGG - Intronic
997854208 5:137358522-137358544 GAGGAGTGGGGGAAGGAAGAGGG + Intronic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998128683 5:139640295-139640317 CAGGAAGGTGGGAGGGAGGAAGG + Intergenic
998170610 5:139870236-139870258 CAGGAGGCGGGGAAGGATGAGGG + Intronic
998417745 5:141957944-141957966 CAGCTCTGGGGGAAGGAGCACGG - Exonic
998812903 5:145984365-145984387 CAGGCTTTGGGGAAGGAGATAGG + Intronic
999151623 5:149430217-149430239 TAAGATTGGGGGAAGGGGGTAGG - Intergenic
999449702 5:151668780-151668802 GAGGGTTGGGGGAAGAAGCATGG - Intronic
999461600 5:151761436-151761458 CAGGCTTGGGAGAGGGAGCATGG + Intronic
1000147573 5:158468296-158468318 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1000467478 5:161597538-161597560 CGGGATGGGGGGAGGGGGGAGGG + Intronic
1000495542 5:161978826-161978848 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1000614683 5:163413933-163413955 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1000798765 5:165697785-165697807 GAGGTTTGGGGGTGGGAGGAGGG + Intergenic
1000802047 5:165739929-165739951 GGAGATTGGGTGAAGGAGGAGGG + Intergenic
1000854400 5:166380505-166380527 TGGGGTTGGGGGAAGGAGGAGGG - Intergenic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1000927310 5:167209694-167209716 CAGAATTGGGGGAATGATGTGGG - Intergenic
1000984867 5:167855768-167855790 AGGGAATGAGGGAAGGAGGAAGG + Intronic
1000984894 5:167855848-167855870 AAGGAATGAGGGAGGGAGGAAGG + Intronic
1001128363 5:169041582-169041604 CTGCATTGGGGAAAGAAGGAAGG - Intronic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001228277 5:169964017-169964039 CAGGATTGGGGGAGGGAGAAGGG + Intronic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001493181 5:172169715-172169737 CAGGATTGAAGGAAGGAGAGAGG - Intronic
1001753425 5:174148374-174148396 CAGAAGTGGAGGAAGTAGGAAGG - Intronic
1001791052 5:174458480-174458502 AAGGATGTGGGGAAGGAGGTGGG - Intergenic
1001886291 5:175293450-175293472 CAGGATTGGGACAAGGACCATGG - Intergenic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002553420 5:180015540-180015562 AAGGAGTAGGGGAAGGAGTAGGG + Intronic
1002844397 6:934200-934222 CAGGCCTGGGGGAAGGATGGGGG + Intergenic
1003031508 6:2605254-2605276 TAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1003202115 6:3970823-3970845 AAGGGTTGGAGGTAGGAGGAGGG + Intergenic
1003455288 6:6276238-6276260 GAGGATTGGAAGCAGGAGGAGGG + Intronic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1004339777 6:14798193-14798215 AAGGGTTGGGGGAGGGAGGAAGG + Intergenic
1004626884 6:17385157-17385179 GAGGGATGGGGGAAGGAGGGAGG + Intergenic
1004895045 6:20140172-20140194 AAGGATTGGGGGTTGGGGGAAGG - Intronic
1004945669 6:20609921-20609943 GAGGATGGAGGGCAGGAGGAGGG - Intronic
1005081912 6:21965276-21965298 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005081918 6:21965291-21965313 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005379990 6:25224233-25224255 GAGGAGTGAGGGAAGGAGAAGGG - Intergenic
1005513127 6:26530013-26530035 CCTGATTGGGCGAAGGTGGAAGG - Intergenic
1006025747 6:31145577-31145599 AAGGACTGGTGAAAGGAGGAAGG + Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006502181 6:34466106-34466128 CGGGGCTGCGGGAAGGAGGAAGG - Exonic
1006827743 6:36948626-36948648 GAGGAAGGAGGGAAGGAGGAAGG - Intronic
1006919379 6:37617387-37617409 CAGGATTTGGTGAGGAAGGAAGG - Intergenic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007373500 6:41441960-41441982 CAGGAAGGAGGGAAGGAGGGGGG + Intergenic
1007424451 6:41737677-41737699 CATGATTGGGGTTGGGAGGAAGG - Intronic
1007616452 6:43182407-43182429 CGGGTTTGGGGGGAGGGGGAAGG - Intronic
1007694872 6:43725625-43725647 CAGGATTGGTGGAGAGAGCAGGG - Intergenic
1007720253 6:43880893-43880915 AGGGATTGGGGGAAGCAAGATGG + Intergenic
1007892539 6:45308592-45308614 TGGGATCGGGGGAGGGAGGAGGG + Intronic
1007981720 6:46166208-46166230 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008092573 6:47308694-47308716 CTGGAATGGGGGGAGGGGGAAGG - Intronic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1008492525 6:52101279-52101301 CAGGTTTGGAAGACGGAGGAGGG - Intergenic
1008736859 6:54555481-54555503 TGGGGTGGGGGGAAGGAGGAGGG + Intergenic
1008950811 6:57156804-57156826 ATGGATTGGGGGCAGGAGGTGGG + Intronic
1009330111 6:62408703-62408725 GAGGATGGAGGGGAGGAGGAGGG + Intergenic
1009904414 6:69850967-69850989 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1009957342 6:70471561-70471583 GAGGATAGGGGGTGGGAGGAGGG + Intronic
1010131069 6:72494072-72494094 TGGGGTTGGGGGAAGGGGGAAGG + Intergenic
1010168166 6:72941523-72941545 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
1010274194 6:73949953-73949975 AGGGAATGGGGGAAAGAGGAAGG + Intergenic
1010361471 6:74999847-74999869 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1010489678 6:76460749-76460771 CAGGATTCAGGGAAAGAGGTGGG - Intergenic
1010682373 6:78811732-78811754 CAGGGTTGGGAGAAAGATGAAGG - Intergenic
1010704410 6:79090177-79090199 AAGGAAGGAGGGAAGGAGGAAGG - Intergenic
1010975147 6:82303519-82303541 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1011097575 6:83683190-83683212 AGAGATTGGGGGAAGAAGGAAGG - Intronic
1011305755 6:85924650-85924672 AAGGGTTGTGGGAGGGAGGAGGG - Intergenic
1011891172 6:92162020-92162042 AAGGAATGAGGGAGGGAGGAAGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012251810 6:96988954-96988976 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1012680102 6:102169312-102169334 TAGGGTTAGGGGAAAGAGGAGGG + Intergenic
1012734315 6:102919713-102919735 AAGGAATGGGAGAAGAAGGAAGG + Intergenic
1012874472 6:104710309-104710331 TAGGACTGGGGAAAGGGGGATGG + Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013737263 6:113242288-113242310 CAGGATGGGGTAAAGGAAGAGGG - Intergenic
1013766284 6:113577995-113578017 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014014804 6:116517993-116518015 CAGGTTTGGGGGAAGGGGCACGG - Exonic
1014315253 6:119856545-119856567 AAGGGAGGGGGGAAGGAGGAAGG - Intergenic
1015190000 6:130461883-130461905 CACAATTGTGGGGAGGAGGAGGG - Intergenic
1015834576 6:137406301-137406323 GAGGATGGGGGGTGGGAGGAGGG - Intergenic
1015976571 6:138796606-138796628 CTGGGTTGGGGGAATGAGGGAGG + Intronic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016236177 6:141869525-141869547 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1016855631 6:148667927-148667949 CAGGGTTTGGGGTAGGGGGAGGG - Intergenic
1016856307 6:148673984-148674006 CAGAATTGGGGCAAGGGAGATGG + Intergenic
1016945640 6:149530206-149530228 CAAGACTGGGGGAAAGAGGGAGG + Intronic
1017112087 6:150941554-150941576 CAGGATGGGGGCAGTGAGGATGG + Intronic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017819053 6:158036622-158036644 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1017978078 6:159375392-159375414 TAGGACTGGGGGACTGAGGACGG - Intergenic
1018160894 6:161041374-161041396 CAGGGTTAGGGGAAGGACCAGGG - Intronic
1018265918 6:162024174-162024196 AAGGGTTGGGGGAGGGAGGGAGG - Intronic
1018397484 6:163389722-163389744 CAAGCTTGGGGTAAGGAGGTGGG + Intergenic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018639007 6:165889902-165889924 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639021 6:165889946-165889968 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639042 6:165890020-165890042 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018710980 6:166497966-166497988 TGGGATTGGGGGAGGGAGGGAGG + Intronic
1018798288 6:167203746-167203768 GAAGAAAGGGGGAAGGAGGAAGG + Intergenic
1018815453 6:167327023-167327045 AGGTATTGGGGGAAAGAGGAAGG + Intronic
1018911980 6:168106479-168106501 CAGGAATGGAGGACGGAGGAGGG + Intergenic
1018955527 6:168407771-168407793 GAGCAATGGTGGAAGGAGGATGG - Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019298348 7:290589-290611 CGGGATGGGGGGAAGGACGGGGG + Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019666120 7:2253010-2253032 CAGGAGTTGGGGGAGCAGGAGGG - Exonic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1020004669 7:4775914-4775936 CAGGCTTGGGGTGAGGAGGTCGG + Intronic
1020124308 7:5524527-5524549 CATGAATGGGGGCAGGGGGATGG + Intergenic
1020773555 7:12426191-12426213 GGGGATTGGGGGCTGGAGGAGGG - Intergenic
1020911782 7:14140284-14140306 CATGAATGGGGGATGGGGGAGGG + Intergenic
1020954106 7:14718490-14718512 CGTGATTGGGGGCAGGAGAAAGG - Intronic
1021332814 7:19359399-19359421 TGGGGTTGGGGGAAGGGGGAGGG + Intergenic
1021656717 7:22880701-22880723 AAGGATGGGAGGAAGGAAGAGGG - Intergenic
1022174929 7:27863580-27863602 CAGTGCTGGGGGAAGAAGGATGG - Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022791414 7:33692964-33692986 CAGGAATGGTGTGAGGAGGAAGG + Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023260413 7:38353089-38353111 AAGGACGGAGGGAAGGAGGAAGG + Intergenic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023475654 7:40575096-40575118 CAGGATGGTGGGCAGGAGGGTGG + Intronic
1023584975 7:41719691-41719713 CAGGAATGGGGGAGGGTGGATGG + Intergenic
1023589870 7:41770342-41770364 GAGGATGGGGGGAAAGGGGAGGG + Intergenic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023825937 7:44008831-44008853 CAGGGGTGGGGGGAGGGGGATGG + Exonic
1024141354 7:46466168-46466190 GAGGATTTGGGGAAGGGGAAGGG + Intergenic
1024507014 7:50170379-50170401 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1024680696 7:51683868-51683890 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1025147048 7:56514192-56514214 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1025147080 7:56514285-56514307 AAGGAGTGAGGGAAGGAGGGAGG - Intergenic
1025160151 7:56651823-56651845 CGGGATTGGGGGCAAGGGGAGGG - Intergenic
1025234656 7:57226541-57226563 CAGGAGTGGAGCAAGGAGGATGG + Intergenic
1025728949 7:64092983-64093005 TAGGGTTGGGGGATGGGGGAGGG + Intronic
1025913422 7:65846436-65846458 TAGGAATGGAGGAAGGAGGAAGG - Intergenic
1026046587 7:66909791-66909813 GGGAATTGGGGAAAGGAGGAGGG - Intergenic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1026602925 7:71791550-71791572 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1026787602 7:73311715-73311737 CAGGATTGTGGGGAGGCTGAGGG + Intergenic
1026804062 7:73418564-73418586 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1027307888 7:76921151-76921173 TAGGATTGGGGCAAGAAAGAAGG + Intergenic
1027456867 7:78403141-78403163 TGGGATGGGGGGAGGGAGGAGGG - Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027823978 7:83087068-83087090 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1028886989 7:95944873-95944895 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029038405 7:97547602-97547624 TGGGATTGGGGGAGGGAGGGAGG + Intergenic
1029204886 7:98863656-98863678 AAGGAAGGAGGGAAGGAGGAAGG - Intronic
1029403331 7:100358519-100358541 CAGGCATGGGGGAGGGTGGAGGG - Intronic
1029405910 7:100373873-100373895 CAGGCATGGGGGAGGGAGGAGGG - Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1029657382 7:101936230-101936252 AAGGATGGGAGGAGGGAGGAGGG + Intronic
1029873455 7:103721210-103721232 AAGGAAGGGTGGAAGGAGGAAGG - Intronic
1029942598 7:104496110-104496132 TGGGGTGGGGGGAAGGAGGAGGG - Intronic
1030070529 7:105693976-105693998 CTGGGGTGGGGAAAGGAGGAGGG + Intronic
1030072196 7:105707444-105707466 AATGAGTGGGGGATGGAGGAAGG + Intronic
1030182939 7:106729792-106729814 GAGCAATGGGGGAATGAGGACGG + Intergenic
1030376853 7:108762325-108762347 GAGGGTTGAGGGCAGGAGGAGGG + Intergenic
1030970678 7:116051147-116051169 TGGGGTTGGGGGAAGGGGGAGGG + Intronic
1031464407 7:122090930-122090952 AGGGGTTGGGGGAAGGAGGATGG - Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031694751 7:124836325-124836347 AGAGCTTGGGGGAAGGAGGATGG - Intronic
1031798224 7:126206170-126206192 CAGGATGGGAGGATGCAGGAAGG + Intergenic
1032023176 7:128421429-128421451 GAGGCTTGGGGGAATGAGGTGGG - Intergenic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032475799 7:132210800-132210822 CAGGCATGGGGGAAGCAGGTAGG + Intronic
1032494297 7:132349311-132349333 CAGCATTGAGGGAAAGAAGAGGG + Intronic
1032500673 7:132397446-132397468 AAGAATTGGGGGAATGAGGTAGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1032978342 7:137251685-137251707 AAGGAGGTGGGGAAGGAGGAAGG - Intronic
1033414094 7:141147240-141147262 CAGGAGGGAGGGAAGGAGAAAGG - Intronic
1033547552 7:142415333-142415355 CAGAATTGGGGGAAAGAATAAGG - Intergenic
1033620263 7:143056135-143056157 TAGGATGGAGGGAGGGAGGAGGG + Intergenic
1033885597 7:145941159-145941181 CAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1034360487 7:150492495-150492517 TAGGGTGGGGGGAAGGGGGAGGG + Intergenic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034569821 7:151946484-151946506 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1034774553 7:153813167-153813189 CAGGGTGGGGGGATGGGGGAAGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034923385 7:155101808-155101830 CCGGCTTGGGAGATGGAGGAAGG - Intergenic
1034954742 7:155327566-155327588 CAGGGTTGGGGGAGAGAGGGGGG - Intergenic
1034985510 7:155511123-155511145 CGAGAGTGGGGGAGGGAGGAAGG - Intronic
1034995146 7:155572211-155572233 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035839270 8:2793347-2793369 CAGGATTGGGGAAGTGGGGAAGG + Intergenic
1035907434 8:3528396-3528418 CACTCGTGGGGGAAGGAGGATGG + Intronic
1036226733 8:6965357-6965379 CAGGACTGGGGCAAGGAGAGAGG + Intergenic
1036389317 8:8310786-8310808 TAGGGTTGGGGGAATGAGGTGGG - Intergenic
1036547267 8:9783793-9783815 GGGGATTGGGGGAAGTGGGATGG + Intergenic
1037112089 8:15175535-15175557 GAGGATGGAGGGTAGGAGGAAGG + Intronic
1037134758 8:15446729-15446751 CAGGAGAGGGGGAGGGAGGGGGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037764464 8:21763756-21763778 CAGGGTAGGGGGACGGATGAGGG - Intronic
1037805664 8:22056868-22056890 CAGGGTGGGGGCAAGGAGGGTGG + Intronic
1037920071 8:22799694-22799716 TGGGATTGGGGGACGGGGGAGGG - Intronic
1038331152 8:26610572-26610594 CGTGATTGAGGGAAGGAGGGTGG - Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038891235 8:31726769-31726791 CTGGAATGAGGCAAGGAGGAGGG + Intronic
1039424596 8:37475713-37475735 CAGGACTGTGTGCAGGAGGATGG + Intergenic
1039609188 8:38905531-38905553 CTTGATTTAGGGAAGGAGGAGGG - Intronic
1039644188 8:39262612-39262634 AGGGATGGAGGGAAGGAGGAAGG - Intronic
1039674153 8:39641480-39641502 GAGGATGGAGGGTAGGAGGAGGG - Intronic
1039849557 8:41352088-41352110 TAGGGTTGGGGGAAGGAGGAGGG - Intergenic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041387654 8:57321090-57321112 CAGGGTTGGGGGACGGGAGAGGG - Intergenic
1041390225 8:57341218-57341240 CAGGTTTTGGGGAACTAGGATGG + Intergenic
1041525487 8:58800864-58800886 TGGGGTTGGGGGAAGGAGGGAGG - Intergenic
1041560556 8:59213492-59213514 GAAGATTGGGGGTAGGAGGAGGG + Intergenic
1041628174 8:60055012-60055034 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042236445 8:66617567-66617589 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1042492190 8:69412234-69412256 GAGGATGGAGGGTAGGAGGAGGG + Intergenic
1043037736 8:75218953-75218975 AAGGATGGAGGGAAGGAGGGAGG + Intergenic
1043443379 8:80296727-80296749 CAGGGTTGGGGGAAAGAGGAGGG + Intergenic
1043586449 8:81775487-81775509 AAGGATAGAGGGGAGGAGGAGGG - Intergenic
1043617363 8:82143574-82143596 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1043848484 8:85188846-85188868 TAGGGTTGAGGGAAGGATGACGG + Intronic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044102683 8:88160112-88160134 TGGGATTGGGGGAAGGGGGAGGG - Intronic
1044801985 8:95966655-95966677 CAGCATCCGAGGAAGGAGGAAGG - Intergenic
1045316648 8:101049243-101049265 AAGGAGGGGGGGAGGGAGGATGG - Intergenic
1045322014 8:101089292-101089314 AAGGATTGGGAGAAGGAAGGAGG + Intergenic
1045474644 8:102542581-102542603 GAGGAGTAGGGGGAGGAGGAGGG - Intergenic
1045750892 8:105482974-105482996 AAGGATGGGGGGAGGGAGGGAGG - Intronic
1045770844 8:105738162-105738184 GAGGATTGAGGGTGGGAGGAGGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1045998882 8:108395944-108395966 CAGGATTGGGGGGTGAGGGATGG + Intronic
1046459188 8:114509888-114509910 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1046538242 8:115544389-115544411 CTGGATTGGAGGCAGGTGGAAGG + Intronic
1046626719 8:116583543-116583565 CATGGTTGGGGGGAGGGGGAGGG + Intergenic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1046719975 8:117608424-117608446 GAGGGAGGGGGGAAGGAGGAAGG - Intergenic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047322550 8:123801671-123801693 CAGCCTTGGGGCAAGGAGAAGGG + Intronic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047907024 8:129483185-129483207 GGGGAAGGGGGGAAGGAGGAAGG + Intergenic
1048132574 8:131714000-131714022 CATCACTGGGGGAAAGAGGAAGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048732573 8:137460037-137460059 CAGGATTTGGGGAAAGACAAGGG + Intergenic
1049019870 8:139948678-139948700 CAGGATTGGGGCTAGGAGCCAGG + Intronic
1049088744 8:140497613-140497635 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049403454 8:142441147-142441169 CAGGAGTGGGGGCTGGAGGTGGG - Intergenic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049746644 8:144265862-144265884 GAGGAACGGGGGAAGGAGGAAGG + Intronic
1049764894 8:144350591-144350613 CAGAACTGGGGCAGGGAGGAGGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050250424 9:3737776-3737798 CAGGATGGCAGGAAGAAGGAAGG + Intergenic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050392151 9:5155325-5155347 CAGGGTTGGGGGAGGGGGGAGGG + Intronic
1050422335 9:5478631-5478653 GAGGGTTGGGGGCATGAGGAGGG - Intergenic
1050433112 9:5582061-5582083 CAGAAGCGGGGGTAGGAGGAGGG + Intergenic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1050912201 9:11085605-11085627 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1050985637 9:12078657-12078679 GGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1051355968 9:16239996-16240018 GAGGGTTGCGGGGAGGAGGAGGG - Intronic
1051720334 9:20030159-20030181 CAGGACTGGAGGGAGGAGGCAGG + Intergenic
1052065708 9:24017215-24017237 GGGGATTGGGGGATGGGGGAGGG - Intergenic
1052205689 9:25837160-25837182 CAGGATTGAAGGAAAGAGGAAGG + Intergenic
1052380722 9:27767860-27767882 CGGGGTTGGGGGAAAGGGGAGGG + Intergenic
1052440800 9:28494358-28494380 TGGGGTGGGGGGAAGGAGGAGGG - Intronic
1052859737 9:33430137-33430159 CAGGATTGGGGGAGGTGGGAAGG - Intergenic
1052892335 9:33713644-33713666 CCAAATTGGGGGAGGGAGGAAGG - Intergenic
1053105730 9:35406323-35406345 CAGGATAGGGGCAAGGGGGGCGG - Intergenic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053233815 9:36434317-36434339 GGGGGATGGGGGAAGGAGGAGGG + Intronic
1053471282 9:38347452-38347474 CAGCACTGGGGGTGGGAGGAGGG - Intergenic
1053512673 9:38702125-38702147 CAGGACTGGGGGACGGAAGATGG + Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053592830 9:39531695-39531717 CATGGTTGGGGGAAAGGGGAGGG + Intergenic
1053666423 9:40321046-40321068 GAGGATGGGGGGTAGTAGGAAGG + Intronic
1053690853 9:40586895-40586917 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1053750585 9:41250517-41250539 GATGAATGAGGGAAGGAGGAGGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054138669 9:61456127-61456149 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054273951 9:63050596-63050618 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1054302111 9:63387866-63387888 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054335216 9:63800752-63800774 GATGAATGAGGGAAGGAGGAGGG - Intergenic
1054377575 9:64461074-64461096 GAGGATAGGGGGTAGTAGGAAGG + Intergenic
1054400889 9:64714372-64714394 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054434495 9:65198686-65198708 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1054495895 9:65822995-65823017 CGGCATTGGGGGACGGAGGTGGG - Intergenic
1054518186 9:66055237-66055259 GAGGATGGGGGGTAGTAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1055549187 9:77414589-77414611 TGGGATGGGGGGAGGGAGGAGGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056185836 9:84134141-84134163 CAGGATTGGTGGAAACAGCAAGG - Intergenic
1056224324 9:84480613-84480635 CAGGCTTGGTGAAAAGAGGAAGG + Intergenic
1056373681 9:85985573-85985595 TAGGATTGGGGGAAGAATCATGG + Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056741162 9:89256619-89256641 GAAGAATGGGGGAAGGAGGAAGG + Intergenic
1056788684 9:89611212-89611234 TAGGCTTGGGGGTAGCAGGAAGG + Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057258527 9:93569833-93569855 CATGGGTGGGGGTAGGAGGAAGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1058040431 9:100296016-100296038 CAGCCTTTGGGGAAGGAGGGAGG + Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058139555 9:101342626-101342648 CAGGAGAGGGGGAAGGAGAGAGG + Intergenic
1058299224 9:103349048-103349070 GAGGAATGGAGGAAGGAGGTGGG - Intergenic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1058998910 9:110327776-110327798 TAGGATTGGGGGGTGGAGGATGG + Intronic
1059350129 9:113658536-113658558 CATGAATGTGGGAGGGAGGAAGG + Intergenic
1059393637 9:114017035-114017057 CATGATTGGGGTGAGGAGGGTGG + Intronic
1059575326 9:115481958-115481980 CAGGATTGTGGTAAGGAAGATGG + Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059952651 9:119482907-119482929 CATGCTTGGTGGCAGGAGGAGGG - Intergenic
1059960334 9:119558440-119558462 CAGCATCTGGGGAAGCAGGAGGG + Intergenic
1060068236 9:120523898-120523920 CAACATTGGGGGACGGAGGGAGG + Intronic
1060247394 9:121957888-121957910 CAGGATTGGGAAGAGAAGGAGGG + Intronic
1060261417 9:122077847-122077869 AAAGATGGGAGGAAGGAGGAAGG + Intronic
1060295151 9:122338296-122338318 CAGGATAGGAGGCTGGAGGATGG - Intergenic
1060801271 9:126547345-126547367 CAGGAGGGGAGGGAGGAGGAAGG - Intergenic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1060952578 9:127613044-127613066 CAGGAGGGTGGGGAGGAGGAGGG - Intronic
1061281960 9:129602670-129602692 CAGGAAGGAGGGAGGGAGGAAGG + Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061610492 9:131742233-131742255 CAGGATTTGGGGGAGGTGCAGGG + Intergenic
1061668082 9:132172064-132172086 TAGGAGCTGGGGAAGGAGGAGGG + Intronic
1061865716 9:133490926-133490948 GAGGAGTTGGGGGAGGAGGATGG + Intergenic
1061868430 9:133507293-133507315 CAGGAGTGTGGGGAGGAGGGAGG - Intergenic
1062032168 9:134366587-134366609 CAGGGCTGGGGCAGGGAGGAAGG + Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062058257 9:134480516-134480538 CAGGTATGCGGCAAGGAGGATGG - Intergenic
1062097946 9:134712362-134712384 CAGGAAGGAGGGAAGAAGGAAGG - Intronic
1062112547 9:134790077-134790099 CAGGATGGGGCATAGGAGGATGG - Intronic
1062225272 9:135446681-135446703 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225343 9:135446868-135446890 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225380 9:135446962-135446984 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225451 9:135447149-135447171 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062273453 9:135720121-135720143 CAGGAATGGGTGCAGAAGGAGGG + Intronic
1062276226 9:135732816-135732838 CAGGAAGGAGGGAAGGAAGAAGG - Intronic
1062437214 9:136551583-136551605 CGAGAAAGGGGGAAGGAGGAAGG - Intergenic
1062529400 9:136993284-136993306 CAGGAGTGGGGGCAAGAGCAGGG - Intronic
1062591181 9:137275510-137275532 CAGGATAGGGGGAAGTGGCAGGG + Intergenic
1062599392 9:137313139-137313161 GAGGCTTGAGGGAAAGAGGAGGG + Intronic
1062686613 9:137816967-137816989 CAGGGCTGGGGGAAGGTGGTTGG - Intronic
1062703957 9:137924336-137924358 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1203621509 Un_KI270749v1:133001-133023 CAGCATTGGGGGACGGAGGTGGG + Intergenic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185500635 X:594512-594534 TAGGACTGGGGGAACAAGGATGG + Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185734314 X:2485653-2485675 GAGGGATGGGGGAAGGAGGGAGG + Intronic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1186551186 X:10507305-10507327 CAGGGTTGTGGGAAGGGAGAGGG + Intronic
1186564115 X:10644005-10644027 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1186681686 X:11881630-11881652 AAGGATTAGGGGTTGGAGGAGGG + Intergenic
1187018737 X:15357552-15357574 CAGAATTGGGGAAAGAGGGATGG - Intronic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187264553 X:17718977-17718999 AAGGATGGAGGGAAGGAAGAAGG + Intronic
1187354472 X:18554206-18554228 TGGGATGGGGGGAAGGGGGAGGG - Intronic
1187543798 X:20227135-20227157 CAGGATTGGGGGAAGAGGTGGGG - Intronic
1187572950 X:20523718-20523740 CAGGATTGGGGGGTGGGGGGTGG + Intergenic
1187825996 X:23334187-23334209 CAGGAGTGGGGGGAGGGGGCGGG - Exonic
1187934109 X:24319314-24319336 TAGGGTAGGGGGAAGGATGAAGG + Intergenic
1188562997 X:31491227-31491249 TTGGATTTGGGGTAGGAGGAAGG + Intronic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189051634 X:37651742-37651764 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1189223889 X:39396577-39396599 CAGGTGTGGAGGAAGGAAGATGG - Intergenic
1189332216 X:40151277-40151299 AGGGATTGGGGCAAGCAGGAGGG + Intronic
1189430037 X:40938159-40938181 AAGGATGGAGGGAAGGAAGAAGG + Intergenic
1189581147 X:42407845-42407867 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1189661435 X:43304204-43304226 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1190093065 X:47456434-47456456 CAGCACTGGGGGATGGAAGAAGG + Intronic
1190276508 X:48902839-48902861 GAGGAATGGAGGAAGGAGGCCGG - Intronic
1190410361 X:50131021-50131043 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1190749870 X:53352734-53352756 GGGGTTTGAGGGAAGGAGGAAGG + Intergenic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1191784762 X:64905484-64905506 TGGGATTGGGGGAAAGAGGATGG + Intergenic
1191814681 X:65230384-65230406 TGGGATGGGGGGAAGGGGGAGGG + Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192225240 X:69222926-69222948 CAGGGTTGGGGGTAGGAAGCAGG - Intergenic
1192237410 X:69304728-69304750 CAGGAATGGGGGAAGGAAGGAGG - Intergenic
1192241759 X:69336757-69336779 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1192374620 X:70547292-70547314 CTGGATTGTGGGAGGAAGGACGG + Intronic
1192511045 X:71720584-71720606 CGGGATTGTGGGAAGGGGCACGG - Intergenic
1192515652 X:71760969-71760991 CGGGATTGTGGGAAGGGGCACGG + Intergenic
1192528860 X:71869723-71869745 CGGGATTGTGGGAAGGGGCATGG + Intergenic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1192582892 X:72299555-72299577 CAAGATTGGGGGAGCTAGGAAGG - Intronic
1192582914 X:72299650-72299672 CTGGATTGGGGGAGCTAGGAAGG - Intronic
1192639453 X:72848099-72848121 AAGGATTGGGGGAGGCAAGATGG + Intronic
1192642258 X:72872706-72872728 AAGGATTGGGGGAGGCAAGATGG - Intronic
1192903488 X:75524129-75524151 CAGGATTTTGGAAAGGAAGATGG + Intergenic
1193289688 X:79757167-79757189 CAGGATGGAGGGTGGGAGGAGGG - Intergenic
1193448042 X:81629331-81629353 AAGGATGGAGGGATGGAGGAGGG - Intergenic
1193478318 X:81995254-81995276 CTGTATTGGGGGCAGAAGGAGGG - Intergenic
1193597167 X:83461063-83461085 CAGGATTGGGAGAGAGAGGGAGG + Intergenic
1193651165 X:84134438-84134460 CAGGAGTTAGGGAAGGTGGAGGG + Intronic
1194801310 X:98276838-98276860 CTGGATGGGGGGAGGAAGGAGGG + Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195563652 X:106315931-106315953 GAGGTTGGAGGGAAGGAGGAAGG + Intergenic
1195683067 X:107563211-107563233 CAGGATTGGGGGATGTGGGGAGG + Intronic
1195897931 X:109767185-109767207 AAGGAAGGGAGGAAGGAGGAAGG + Intergenic
1195977373 X:110542269-110542291 GAGGATGGAGGGAGGGAGGATGG - Intergenic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198234821 X:134726967-134726989 CTGGATGGGGGTAAAGAGGAGGG - Intronic
1198327178 X:135585394-135585416 CAAGAGTGGGGGAAGGAGGGAGG + Intergenic
1198409942 X:136356560-136356582 GAGAATTGGGGCAAGGATGATGG - Intronic
1198502443 X:137265133-137265155 AAGGAATGAGGGAAGGAGGGAGG + Intergenic
1198583834 X:138097067-138097089 TGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic
1198709025 X:139481362-139481384 CGGGGTTGGGGGAAAGGGGAGGG - Intergenic
1198985455 X:142447218-142447240 CAGGAATGTGAGAATGAGGATGG + Intergenic
1199361904 X:146930186-146930208 CAGCATTTGTGGAAGAAGGAGGG + Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199595751 X:149504771-149504793 AAAGATGGGGGGAAAGAGGAAGG + Intronic
1199600107 X:149536802-149536824 CAGGGTTGGGGGCAGGGGGTGGG + Intergenic
1199650476 X:149943138-149943160 CAGGGTTGGGGGCAGGGGGTGGG - Intergenic
1199748054 X:150787745-150787767 TGGGATTGGGGGAGGGGGGAGGG + Intronic
1199942918 X:152641983-152642005 CAGGACCGGGGGAGGGAGCAGGG + Intronic
1200134472 X:153868186-153868208 CAGGAGCGGGGGAAGGAGACAGG - Intronic
1200174371 X:154102431-154102453 GAGGATCGGGGAGAGGAGGATGG + Intergenic
1200564742 Y:4751599-4751621 TGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1201189556 Y:11435592-11435614 CGGCATTGGGGGACGGAGGTGGG + Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201341100 Y:12935498-12935520 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201690577 Y:16760250-16760272 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201711794 Y:17000635-17000657 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1202241308 Y:22773394-22773416 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202300723 Y:23410963-23410985 CAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1202394294 Y:24407137-24407159 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202476491 Y:25262955-25262977 GAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1202570088 Y:26259635-26259657 CAGGGTGGAGGGTAGGAGGAGGG - Intergenic