ID: 1096777660

View in Genome Browser
Species Human (GRCh38)
Location 12:53973930-53973952
Sequence AGCAGCGGCCGGGGAACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096777646_1096777660 5 Left 1096777646 12:53973902-53973924 CCGGCCAAAGGAGCCGCCCCCAG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777643_1096777660 19 Left 1096777643 12:53973888-53973910 CCGTGGCCAAGGAGCCGGCCAAA 0: 1
1: 0
2: 2
3: 6
4: 120
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777649_1096777660 -8 Left 1096777649 12:53973915-53973937 CCGCCCCCAGTAGGTAGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777640_1096777660 25 Left 1096777640 12:53973882-53973904 CCCACTCCGTGGCCAAGGAGCCG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777641_1096777660 24 Left 1096777641 12:53973883-53973905 CCACTCCGTGGCCAAGGAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777647_1096777660 1 Left 1096777647 12:53973906-53973928 CCAAAGGAGCCGCCCCCAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777645_1096777660 13 Left 1096777645 12:53973894-53973916 CCAAGGAGCCGGCCAAAGGAGCC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096777660 Original CRISPR AGCAGCGGCCGGGGAACGGG CGG Intronic
900166766 1:1247056-1247078 AGCAGCGGCCGGGGTCAGTGGGG - Intergenic
900393929 1:2445403-2445425 GGCAGTGGTCGGGGAACTGGTGG + Intronic
901327792 1:8379317-8379339 AGCTGCGACCGGGGAAAGGAGGG + Intronic
901332932 1:8424238-8424260 AGCGGCGGCCGGGGAAGTGCAGG - Intronic
902839003 1:19063645-19063667 AGCAGCAGCCGGGGAGCTGGCGG - Intergenic
904034631 1:27552000-27552022 AGCAGGGGCCGGGGGGTGGGGGG + Exonic
904237514 1:29124435-29124457 AGCAGCGCCCGGGGAGGGGCGGG + Intergenic
904814091 1:33182123-33182145 CGCAGCGGGCGGGGGAGGGGCGG + Intergenic
905797572 1:40824192-40824214 GGCAACGGGCGGGTAACGGGAGG - Exonic
906242332 1:44249621-44249643 AGCTGTGGCCTGGGAAAGGGTGG - Intronic
906843859 1:49168892-49168914 AGCAGCCGCTGGGGACCAGGTGG + Intronic
909958236 1:81802972-81802994 TGCAGGGGCCGGGGACCCGGCGG + Intronic
912521816 1:110250820-110250842 AGGAGCGGCTGGGGTAGGGGAGG + Intronic
912697555 1:111852878-111852900 AGCAGGGGTCGGGGAAGTGGAGG - Intronic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
915574709 1:156767949-156767971 AACAGCGGCGGGGGAAAGGCTGG - Exonic
916714452 1:167437701-167437723 ACCAGAGGCTGGGGAATGGGGGG + Intronic
918015989 1:180632533-180632555 GGCCGGGGCCGGGGAACGGTGGG + Intronic
918390202 1:184051792-184051814 TGCAGCGGCCTGGGTCCGGGCGG + Exonic
918394368 1:184098567-184098589 ACCAGAGGAAGGGGAACGGGGGG + Intergenic
919784787 1:201252256-201252278 AGCAGGGGCCTGGGAGCTGGAGG - Intergenic
920352069 1:205343950-205343972 AGCAGCGGGTGGGGAGGGGGCGG - Intronic
921930174 1:220748471-220748493 GGCAGCGACCGGAGACCGGGAGG - Exonic
922526615 1:226309064-226309086 AGCAGCAGGCGGGAAAAGGGGGG + Intronic
922851282 1:228735763-228735785 CGCAGCGGTCGGGGAACGCGGGG - Exonic
1062813825 10:484823-484845 AGCTGCGGCTCGGGAGCGGGTGG - Intronic
1069623610 10:69853001-69853023 AGCTGGGGCGGGGGAGCGGGGGG + Intronic
1070585434 10:77762465-77762487 ACCAGAGGCTGGGGAAGGGGAGG - Intergenic
1070716362 10:78725024-78725046 GACTGCGGCCGGGGAATGGGTGG - Intergenic
1070800698 10:79243115-79243137 AGCCGCGGCGGGGGGAGGGGAGG - Intronic
1071600405 10:86956131-86956153 AGCAGGGGGCGGGGGAGGGGCGG - Intronic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1073461348 10:103667606-103667628 AGCTGTGGGCGGGGAATGGGAGG - Intronic
1074165660 10:110871997-110872019 AGCAGCGGCGGGGGCCCGAGGGG + Exonic
1075007697 10:118842468-118842490 GGCAGCGGCAGGGGGTCGGGGGG - Intergenic
1076443623 10:130497215-130497237 AGCAGATGTCGGGGAGCGGGTGG + Intergenic
1077334286 11:1996608-1996630 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1077962464 11:7089634-7089656 AGCAGCGGCGGTGGAATGCGCGG + Exonic
1078147254 11:8730368-8730390 AGCAGCTGCTGGGGAGCTGGGGG + Exonic
1081811896 11:45918778-45918800 AGCAGCCTCCCTGGAACGGGTGG + Intronic
1082841065 11:57690275-57690297 AGTAGGGGCCGGGGAAAGTGAGG + Intronic
1083270879 11:61571969-61571991 AGCAGGGACCGGGGATAGGGTGG - Intronic
1083729091 11:64643347-64643369 GGGAGCGGCCGGGGGAGGGGGGG + Intronic
1083741472 11:64713719-64713741 AGCGGGGGCCGGGGGCCGGGCGG - Exonic
1083958780 11:66002522-66002544 AGGAGCGGCCGGGTGGCGGGAGG + Exonic
1084091721 11:66883157-66883179 AGCAGCCGAGGGGGAAAGGGTGG + Intronic
1084336545 11:68461010-68461032 AGGAGCGGACGGGGAGCGGCCGG - Intronic
1085474840 11:76783287-76783309 GGCTGCGGGCGGGGACCGGGGGG + Intronic
1087810815 11:102607620-102607642 AGCAGCGGCAAGCGATCGGGTGG + Intronic
1089499286 11:118923114-118923136 AGCAGCTGCCGGGGCAGGAGTGG - Intronic
1090198892 11:124839831-124839853 ATCAGCGGCCGCGGGGCGGGAGG - Intergenic
1091145862 11:133279633-133279655 AGCAGCAGCCGGGCATGGGGTGG - Intronic
1091168665 11:133501962-133501984 AGCAGCGGTCGTGGAAGGGGCGG - Intronic
1202817269 11_KI270721v1_random:51790-51812 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1093019935 12:14193934-14193956 AGCAGCTGCCGGGGAAAAGTGGG + Intergenic
1094624112 12:32106777-32106799 AGCAGGGGGCGGGGAGCGGATGG - Intergenic
1095977130 12:47947429-47947451 AGCAGCTGGTGGGGAAGGGGTGG - Intergenic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1097166681 12:57089762-57089784 AGCATCAGCGGGGGAAAGGGGGG + Intronic
1102452987 12:113055630-113055652 AGCAGGGGCCTGGGGAGGGGAGG + Intergenic
1103511346 12:121476737-121476759 GGCAGCAGCCAGGGAAAGGGAGG - Intronic
1104855005 12:131897397-131897419 AGCAGGGGCCTGAGAACGGAGGG - Intronic
1104934042 12:132355130-132355152 AGCTCCGGCCGGGGAAGGGACGG - Intergenic
1104948248 12:132427074-132427096 AGGAGCGGCAGGGACACGGGAGG + Intergenic
1105498421 13:20950624-20950646 ACCAGGGGCTGGGGAAAGGGCGG - Intergenic
1109562867 13:64075924-64075946 AACAGCAGCCAGGGAACAGGAGG + Intergenic
1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG + Intronic
1113576299 13:111397550-111397572 AGCAGGGGCTGAGGAGCGGGAGG - Intergenic
1113895071 13:113759178-113759200 TGCAGGGGGCGGGGAAGGGGCGG + Intergenic
1113949965 13:114066387-114066409 GCCAGCGGCCGAGGAGCGGGAGG + Intronic
1113962276 13:114132655-114132677 AGCAGGGGCCGGGCCGCGGGCGG - Intergenic
1114987883 14:28252593-28252615 AGCAGCAGCCAGGGAATGGTTGG - Intergenic
1119762008 14:77158243-77158265 AGCAGGGGACAGGGAGCGGGCGG + Intronic
1119762020 14:77158300-77158322 AGCAGGGGACAGGGAGCGGGCGG + Intronic
1120191449 14:81443774-81443796 AGCAGGGGTGGGGGAAAGGGGGG - Intergenic
1121008324 14:90504663-90504685 AGCAGGGGGCCGGGAACGGTTGG - Intergenic
1121050477 14:90816421-90816443 AGCGCCGGCTGGGGAAGGGGCGG + Intronic
1124347329 15:28931339-28931361 AGCGGGGGCCTGGGAATGGGAGG + Intronic
1128139207 15:65286810-65286832 AGCAGCCCCCGGGGGACGGCGGG + Exonic
1129144303 15:73633258-73633280 AGCCGGGGCCGGGGAAGGGAGGG + Exonic
1129706346 15:77796686-77796708 AGGAGAGGCTGGGGAATGGGAGG - Intronic
1132683548 16:1153288-1153310 AGCCGCGGCCGGGAGCCGGGCGG + Exonic
1133156570 16:3880475-3880497 GGCGGCGGCGGCGGAACGGGGGG - Exonic
1133222165 16:4323444-4323466 AGCAGCGGGCAGGCAGCGGGGGG + Intronic
1134858352 16:17539263-17539285 AGGAATGGCCGGGGAACGGGGGG - Intergenic
1137978983 16:53054415-53054437 AGCAGTGGAAGGGGAAGGGGCGG - Intergenic
1142047034 16:87932190-87932212 GGCAGCGGCCGTGGGAGGGGGGG - Intronic
1142131624 16:88433945-88433967 AGCAGCTGCTGGGGGCCGGGAGG - Exonic
1142141695 16:88475497-88475519 AGCAGGGGCAGGGGTCCGGGGGG + Intronic
1142179781 16:88662795-88662817 AGCCGTCGCGGGGGAACGGGTGG + Intronic
1142759468 17:2034633-2034655 AGCAGGGGAGGGGGAAGGGGAGG - Intronic
1143350999 17:6288273-6288295 ACCAGCTGCCGGGGGGCGGGTGG - Intergenic
1144686515 17:17229525-17229547 GGCAGCTGCCGGGGACTGGGAGG + Intronic
1147677734 17:42219347-42219369 AGCAGCTGGCCGGGAACGGCGGG - Exonic
1147688302 17:42300224-42300246 AGCAGCTGGCCGGGAACGGCGGG + Exonic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1150675589 17:67244573-67244595 AGGAGGGGGCGGGGAAAGGGGGG + Intronic
1151265879 17:72954536-72954558 GGCAGAGGCTGGGGAATGGGAGG - Intronic
1151547474 17:74801984-74802006 AGCAGTGGCGGAGGAATGGGTGG - Intronic
1151804457 17:76396953-76396975 AGCAGAGGTCAGGGAAAGGGTGG - Intronic
1152233079 17:79124733-79124755 AGCAGAGGCGGGGTAAGGGGTGG - Intronic
1152236576 17:79142230-79142252 GCCAGAGGCCGGGGACCGGGAGG - Intronic
1152433382 17:80261218-80261240 GGAAGTGGCCGGGGCACGGGGGG + Intronic
1153192958 18:2562754-2562776 ACCAGCAGCTGGGGGACGGGGGG + Intronic
1153290710 18:3499125-3499147 AGGAGCGGCCGGGGGAGGAGGGG + Exonic
1154494329 18:14944630-14944652 ATCAGCGGCAGGGGGCCGGGGGG + Intergenic
1155392093 18:25349588-25349610 CACAGCGGCCGGGGGCCGGGAGG + Intronic
1156495852 18:37524804-37524826 AGCCGCGGCCGGGGCGCGGAGGG - Intronic
1157696071 18:49724791-49724813 ACCAGGGGTCGGGGAAAGGGGGG - Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1160997154 19:1888099-1888121 AGCAGAGGCAGGGGAACGCTGGG - Intergenic
1161378791 19:3953628-3953650 AGCAGCTGCAGGGGGGCGGGGGG + Intergenic
1161518505 19:4710498-4710520 AGGAGCAGCGGGGGAACGTGCGG - Intronic
1161656791 19:5521170-5521192 AGCAGAGGCTGGGGAGGGGGAGG + Intergenic
1161733752 19:5978013-5978035 GCTGGCGGCCGGGGAACGGGCGG - Intronic
1161973345 19:7596018-7596040 CGCAGCGGCCCGGGCCCGGGGGG - Exonic
1162289625 19:9768993-9769015 CGCAGCGGGCGGGGCACGCGTGG + Intronic
1162761415 19:12890966-12890988 AGAAGCGGACGGGGTAGGGGCGG - Intergenic
1163368250 19:16888158-16888180 AGCACCTGCCGAGGACCGGGGGG - Intergenic
1163584449 19:18156212-18156234 AGCAGGGGCCCTGGAAAGGGGGG + Intronic
1163762744 19:19146218-19146240 AGCAGCGGCCGGGGCTTTGGAGG + Intronic
1164700060 19:30278727-30278749 AGCAGTGGCAGGGGAAAGGCAGG - Intronic
1165089173 19:33373741-33373763 GGCCGCGGCTGCGGAACGGGCGG + Exonic
1165923892 19:39315222-39315244 TGCAGCGGCCGGGGCAGGGCTGG + Exonic
1165924866 19:39320758-39320780 TGCAGCGGCCCGGGAGCGGCGGG - Intergenic
1166375220 19:42324051-42324073 GGCGGCGGCCGGGGAGCTGGGGG - Intronic
1166379098 19:42345454-42345476 AGTAGCTGCCAGGGACCGGGGGG - Intronic
1167035271 19:46991531-46991553 TGCAGCAGCCTGGGAAAGGGTGG + Intronic
1167149897 19:47702426-47702448 AGGAGGGGACGGGGAAGGGGAGG - Exonic
1167410011 19:49339007-49339029 AGTAGCGGCCTGAGAAAGGGCGG + Intronic
1167569863 19:50280332-50280354 GGCAGCTGCCAGGGAACGGGCGG + Exonic
1167960954 19:53103622-53103644 AGGAGCCGCCGGGGAAGGGCGGG + Intergenic
928344318 2:30476729-30476751 GGCAGGGGCAGGGGAAGGGGTGG - Intronic
932349409 2:71020398-71020420 AGGAGCTGCCGGGGGAGGGGTGG - Intergenic
932589934 2:73059175-73059197 AGCAGGGGCCGTGGAAAAGGAGG + Intronic
935622817 2:105144075-105144097 CGCAGCTGCCGGGGGCCGGGAGG - Intergenic
937262648 2:120596279-120596301 AGCAGTGGCCGGGGAGCAGCAGG - Intergenic
937917461 2:127106159-127106181 TCCGGCGGCCGGGGAGCGGGTGG - Intronic
938074249 2:128323312-128323334 ACCAGGGGCCGGGGCACAGGTGG + Intergenic
939991080 2:148876736-148876758 GACAGCGGGCGGGGAAGGGGCGG - Intronic
940791427 2:158033562-158033584 AGAAGAGGCTGGGGAATGGGCGG + Intronic
941686837 2:168456295-168456317 AGCAGCGGCCGCGGAGGAGGCGG + Exonic
941762094 2:169254898-169254920 AGCGGCGGGAGGGGGACGGGAGG + Intronic
945063181 2:205925947-205925969 AGAAGCGGCCCCGGACCGGGAGG - Intergenic
945281566 2:208040317-208040339 AACAGTGGCGGGGGAGCGGGGGG - Intergenic
946310569 2:218880657-218880679 TGCAGCGGGCTGGGGACGGGAGG - Exonic
946416589 2:219543170-219543192 GGCAGCGGCCGGGAAGCGCGCGG - Intronic
948122877 2:235543959-235543981 AGCAGTGGCCTGGGCACAGGCGG - Intronic
948734074 2:239987700-239987722 CGCAGCGCCCAGGGAAGGGGTGG + Intronic
949047206 2:241877605-241877627 AGCGGTGGCCGGGGAGCTGGGGG - Intergenic
949075521 2:242055269-242055291 AGCAGCGGCCGGAGAAGTGTGGG + Intergenic
1170605515 20:17872725-17872747 AGCAGCCTCCTGGGAACGGAAGG - Intergenic
1171034555 20:21705180-21705202 GGCAGCGGCCGGGGAAGGGTGGG - Intergenic
1175943277 20:62547573-62547595 AGGAGCAGCCGGGGAGCAGGGGG - Intergenic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1180099047 21:45575844-45575866 AGCAGCAGGTGGGGAACTGGTGG - Intergenic
1180568673 22:16696776-16696798 ACCAGGGGCAGGGGAGCGGGTGG + Intergenic
1180641711 22:17304315-17304337 AGCAGCGGCCTGGGGACGAGAGG - Intergenic
1180891451 22:19291804-19291826 GGCAGGGGCGGGGGAAGGGGCGG - Intergenic
1181562923 22:23716146-23716168 AGCTGGGCCCGGGGATCGGGAGG - Intergenic
1181855670 22:25779964-25779986 AGCAGGGGCCGTGGAAAAGGTGG + Intronic
1185289150 22:50015320-50015342 AGGCGCGGCCGGGGAATGTGGGG - Intronic
954388820 3:50258431-50258453 AAAAGCGGCGGGGGAACAGGCGG - Exonic
956674857 3:71724680-71724702 AGCAGCGGCCGGACACGGGGTGG + Intronic
960096752 3:113696666-113696688 AGCTGCGGCCGCGGGAGGGGCGG - Intergenic
960198906 3:114807426-114807448 AGCAGCTGCAGGGGAGGGGGAGG - Intronic
961037096 3:123650027-123650049 AACAGGGTCCGGGGAACAGGAGG + Intronic
962367651 3:134796631-134796653 AACAGAGGCGGGGGAAGGGGCGG - Intronic
964703621 3:159595366-159595388 AGCAGCAGCCAGGGAAGGGAAGG + Intronic
964720401 3:159763925-159763947 AGCCGCGGGCGGGGAAGGGGCGG + Intronic
967055649 3:185826172-185826194 GTCAGCGGCCGGGGGACGGATGG + Intergenic
968745214 4:2356425-2356447 ATCAACGGCCGGGGAGGGGGCGG - Intronic
969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG + Intronic
969734362 4:8977185-8977207 ATCCGGGGCCGGGGAACGGGGGG - Intergenic
975658691 4:76667058-76667080 GGCAGGGGCTGGGGAATGGGAGG + Intronic
981136901 4:141220821-141220843 AGGAGTGGGCGGGGAAGGGGCGG + Intergenic
984431110 4:179650262-179650284 AGCAGTGGCCAGGGAAGTGGAGG - Intergenic
984973379 4:185209766-185209788 AGCGCCGGCGGGGGACCGGGGGG + Intronic
985508643 5:299219-299241 AGCAGCGGAGGGGGAACAGCTGG - Intronic
985781119 5:1872350-1872372 AGCAGGGGCCAGGCCACGGGGGG - Intergenic
985936759 5:3103284-3103306 TGCAGCCGCCGGGGGACTGGAGG - Intergenic
985951634 5:3225831-3225853 AGGAGCGGCCGGGGAGACGGAGG + Intergenic
987204037 5:15606695-15606717 AGCAGGGGCTGGGGAAGGAGAGG - Intronic
989785902 5:45329264-45329286 ACCAGGGGCTGGGGAAGGGGAGG - Intronic
995106529 5:108382018-108382040 CGGAGCGGCCGGGGAAAGGCCGG + Exonic
997266326 5:132497114-132497136 GGCGGGGGCCGGGGGACGGGCGG + Intergenic
997825003 5:137098429-137098451 AGCAGGGGCCTGGCAAAGGGTGG + Intronic
998236432 5:140402154-140402176 GGCAGCGGCAGCGGTACGGGCGG + Exonic
1000926320 5:167198844-167198866 AACAGCGGCAGGAGAAAGGGGGG + Intergenic
1002163730 5:177332280-177332302 AGCACGGGCCGGGGATCAGGGGG + Intronic
1002431711 5:179207941-179207963 ACCAGGGGCTGGGGAACGAGCGG - Intronic
1003507606 6:6752441-6752463 AGCAGGGGCTGGGGGATGGGAGG + Intergenic
1004457137 6:15801591-15801613 AGCAGGGGCAAGGGAAAGGGTGG + Intergenic
1006136021 6:31897111-31897133 AGCCGAGGCCGCGGAAGGGGGGG - Intronic
1006789338 6:36688925-36688947 AGCAGCGGCCGGAGCAAGAGAGG - Intergenic
1007623496 6:43229162-43229184 CGCAGCTGCCGGGGGTCGGGGGG + Intronic
1007636263 6:43301594-43301616 AGTGGCCGCCGGGGAACGGGTGG + Exonic
1010082998 6:71886364-71886386 GGTAGCGGCCGGGGCACGCGTGG + Intergenic
1012929512 6:105302489-105302511 AGCAGCAGCCGCGGAAGGAGCGG - Intronic
1013005333 6:106067702-106067724 ACCAGGGGCCGGGGAAAGGGAGG + Intergenic
1015054461 6:128883134-128883156 AGCAGCTGCTGGGGAAGAGGAGG - Intronic
1017738125 6:157381643-157381665 AGGCGCGGCCGGGGAGCCGGGGG + Exonic
1017822024 6:158056497-158056519 AGCACCTGCAAGGGAACGGGAGG - Intronic
1017899289 6:158705559-158705581 AGCAGCGGGGGGGGACCTGGGGG + Intronic
1018629478 6:165809793-165809815 AGCATCAGCCCTGGAACGGGCGG + Intronic
1019732738 7:2636819-2636841 GGCAGCGGCCGGGCCAAGGGTGG - Intronic
1021171105 7:17398937-17398959 AACAGCGGTGGGGGAACGAGGGG + Intergenic
1021331048 7:19339698-19339720 AGCAGCGAGTGGGGAACGGTGGG - Intergenic
1022660129 7:32359209-32359231 AGCAGGGTTCGGGGAAAGGGAGG - Intergenic
1023637073 7:42222980-42223002 AGCAGGGGCGGGGGGACGGCGGG - Intronic
1026941216 7:74289213-74289235 AGCTGCGGCCTGGGAAGGGAAGG + Intergenic
1026949589 7:74338478-74338500 AGCTGCGGCCGGGGAGGAGGAGG - Exonic
1027187566 7:75981215-75981237 GGCAGGGGCCGTGGAACGTGAGG + Intronic
1029238626 7:99143481-99143503 GGCAGGTGCGGGGGAACGGGAGG + Intronic
1029646138 7:101857177-101857199 AGCAGAGGCCTGGGAGAGGGAGG - Intronic
1032020128 7:128403092-128403114 AGAAGAGGCCTGGGAAGGGGTGG - Intronic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034255169 7:149720791-149720813 AGCAGCCGCAGGGGTGCGGGGGG + Intronic
1034470456 7:151251890-151251912 GGCGGCGGCCGGGGAGCTGGGGG + Intronic
1034531157 7:151697173-151697195 AGCAGCTGCTGGGGAACGGGGGG + Intronic
1034560479 7:151876672-151876694 GGCAGCGGCCGGGGGAGGGAAGG - Exonic
1035375569 7:158404819-158404841 AGCTGGGGCCGGGGAGCTGGGGG - Intronic
1035667198 8:1388093-1388115 AGCAGAGGCCGTGGATGGGGAGG + Intergenic
1035667258 8:1388398-1388420 AGCAGAGGCCGTGGATGGGGAGG + Intergenic
1035667297 8:1388601-1388623 AGCAGAGGCCGTGGATGGGGAGG + Intergenic
1035667345 8:1388855-1388877 AGCAGAGGCCGTGGATGGGGAGG + Intergenic
1038573493 8:28683911-28683933 GGCAGCGGTGGGGGAAAGGGGGG - Intronic
1039547698 8:38421564-38421586 AGCAGAGGCAGGTGTACGGGTGG + Intronic
1039608483 8:38901416-38901438 TGCAGGGGCCGGGGCTCGGGCGG - Exonic
1040518103 8:48150836-48150858 TGCAGAGGCAGGGGACCGGGAGG + Intergenic
1044656424 8:94553451-94553473 TGCCGCGGGCGGGGAACAGGGGG + Exonic
1045852084 8:106713964-106713986 AGCAGCAGCCAGAGAATGGGAGG + Exonic
1049109701 8:140635387-140635409 GGCAGGGGCCGGGGATCGGGGGG - Intronic
1049121985 8:140747543-140747565 AGAAGAGGAGGGGGAACGGGAGG + Intronic
1049180355 8:141219043-141219065 AGCAGCAGCCGGTGAGCCGGTGG + Intronic
1049405376 8:142449882-142449904 AGCAGGCGCGGGGGAACGGGAGG + Exonic
1050155952 9:2666730-2666752 GGCAGCGGCCGGGGGCGGGGTGG - Intergenic
1053014138 9:34652217-34652239 GGCAGCGGCCGCGGAAGGTGAGG + Intronic
1056360675 9:85854674-85854696 AGCAGGGGGCGGGGAAGGGACGG + Intergenic
1057842971 9:98501129-98501151 AGCAGGGGGCGGGGAAGGGGGGG - Intronic
1058975412 9:110121510-110121532 AGCAGGTGCAGGGGAAAGGGTGG - Intronic
1060945890 9:127569150-127569172 GGCAGCGGGCGGGGAGGGGGCGG - Intronic
1061445655 9:130635800-130635822 AGCAGGGGCCGGGCAACAAGAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1203778078 EBV:85270-85292 GGCCTCTGCCGGGGAACGGGTGG - Intergenic
1203778100 EBV:85330-85352 GGCCTCTGCCGGGGAACGGGCGG - Intergenic
1188003832 X:25004446-25004468 AGCAGGGGCAGGGGCAGGGGCGG + Exonic
1189333460 X:40156398-40156420 AGCAGCGGCAGGGGATGAGGAGG + Intronic
1190421305 X:50287334-50287356 AGGAGGGGCCGGGGAAGGGAAGG - Intronic
1197746018 X:129932511-129932533 AGGAGCGACCCGGGAACCGGAGG - Intergenic
1198407606 X:136330255-136330277 AGCAGCGTAGGGGGAAAGGGTGG - Intronic
1199900332 X:152166486-152166508 AGCAGGGGACGGGGAAAGGATGG + Exonic