ID: 1096777660

View in Genome Browser
Species Human (GRCh38)
Location 12:53973930-53973952
Sequence AGCAGCGGCCGGGGAACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096777647_1096777660 1 Left 1096777647 12:53973906-53973928 CCAAAGGAGCCGCCCCCAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777645_1096777660 13 Left 1096777645 12:53973894-53973916 CCAAGGAGCCGGCCAAAGGAGCC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777649_1096777660 -8 Left 1096777649 12:53973915-53973937 CCGCCCCCAGTAGGTAGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777646_1096777660 5 Left 1096777646 12:53973902-53973924 CCGGCCAAAGGAGCCGCCCCCAG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777640_1096777660 25 Left 1096777640 12:53973882-53973904 CCCACTCCGTGGCCAAGGAGCCG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777641_1096777660 24 Left 1096777641 12:53973883-53973905 CCACTCCGTGGCCAAGGAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236
1096777643_1096777660 19 Left 1096777643 12:53973888-53973910 CCGTGGCCAAGGAGCCGGCCAAA 0: 1
1: 0
2: 2
3: 6
4: 120
Right 1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096777660 Original CRISPR AGCAGCGGCCGGGGAACGGG CGG Intronic