ID: 1096777936

View in Genome Browser
Species Human (GRCh38)
Location 12:53975019-53975041
Sequence TGCCCGGGTGCTGCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096777932_1096777936 -3 Left 1096777932 12:53974999-53975021 CCTGGCAGGGGGTCGAGGCTTGC 0: 1
1: 0
2: 0
3: 3
4: 141
Right 1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 328
1096777929_1096777936 6 Left 1096777929 12:53974990-53975012 CCCGCTAGACCTGGCAGGGGGTC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 328
1096777930_1096777936 5 Left 1096777930 12:53974991-53975013 CCGCTAGACCTGGCAGGGGGTCG 0: 1
1: 0
2: 1
3: 2
4: 126
Right 1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096777936 Original CRISPR TGCCCGGGTGCTGCGGCTGC AGG Intronic
900158151 1:1211782-1211804 GGGCCTGGTGCTGGGGCTGCTGG - Exonic
900210220 1:1451903-1451925 TGTCAGGGTGCGGCGTCTGCAGG + Intronic
900215770 1:1480724-1480746 TGTCAGGGTGCGGCGTCTGCAGG + Intronic
900511453 1:3062923-3062945 TGCCCGGGCGCTCTGGCTGCTGG - Intergenic
900618051 1:3574134-3574156 GGCCTGGGTGCTGAGGCTCCAGG + Intronic
900637506 1:3673100-3673122 TGCCCAGTTGCAGCGGCAGCCGG - Intronic
901324886 1:8360277-8360299 TGCTCTGGTGCGGCGGCTTCAGG - Exonic
902203168 1:14848950-14848972 GGGCCGGATGCTGCGGCTCCAGG + Intronic
902578249 1:17392108-17392130 TGGCAGGGAGCTGCAGCTGCAGG + Exonic
902813578 1:18903126-18903148 TTCCCGGGGGCTGCGGCCCCTGG + Intronic
903413818 1:23168237-23168259 GGCCCGGGAGCTGCAGCAGCAGG - Intronic
903424220 1:23241320-23241342 TGCCCGGGTGCGGTGGCTCACGG + Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904831650 1:33309538-33309560 TTCCCAGGTGGGGCGGCTGCCGG + Intronic
905412302 1:37779038-37779060 TGGCAGGGTGCTGGGGCTGAAGG + Intergenic
905416493 1:37808027-37808049 CGCCCGGCTGTTGCGGCTCCCGG - Exonic
906004511 1:42456968-42456990 TACCAGGAGGCTGCGGCTGCAGG + Exonic
906129765 1:43449085-43449107 CTCCCAGGTGCTGCGGCTGCTGG - Intronic
906202976 1:43971742-43971764 TGCCCGCGTGGTAGGGCTGCTGG + Exonic
907421863 1:54353086-54353108 TGCACGGGGGCTCCAGCTGCAGG + Intronic
913681091 1:121187226-121187248 AGGCCGGGTGCGGCGGCGGCTGG - Exonic
914032921 1:143974866-143974888 AGGCCGGGTGCGGCGGCGGCTGG - Intergenic
914156525 1:145093100-145093122 AGGCCGGGTGCGGCGGCGGCTGG + Exonic
915489170 1:156242002-156242024 TGGTTGGGAGCTGCGGCTGCTGG - Exonic
918064464 1:181089797-181089819 TGCCCGGGCTCGGCGGCTTCCGG - Exonic
918732308 1:188013562-188013584 TGCCCGGCTGCTCCGAGTGCGGG + Intergenic
920468403 1:206205750-206205772 GGGCCGGGTGCGGCGGCGGCTGG - Intronic
920555359 1:206900318-206900340 TGCCCGGCTGCTGCAGCAGGAGG + Exonic
921985315 1:221306073-221306095 TGTCCTGGAGGTGCGGCTGCAGG + Intergenic
923020542 1:230159993-230160015 CACCTGGGTGGTGCGGCTGCTGG - Intronic
923119697 1:230978734-230978756 TGTCCTGCTGCTGCTGCTGCTGG - Exonic
924260283 1:242222641-242222663 TGCCTTGGGGCTGGGGCTGCAGG - Intronic
1062909787 10:1205169-1205191 TGCCCGGGGGCTGCCTCGGCTGG + Intronic
1065926102 10:30434624-30434646 TGCCCTGGCGCTGCGGATACGGG - Intronic
1070742897 10:78914065-78914087 GGCCCGGCTGCTGCCGCTGCTGG + Intergenic
1070794214 10:79207553-79207575 TGCCAGGGTGCTGGGCCTCCTGG - Intronic
1072520952 10:96229738-96229760 TCTCAGGGAGCTGCGGCTGCTGG + Intronic
1076438163 10:130460383-130460405 TTCCCACGTGCTGCTGCTGCTGG - Intergenic
1076675137 10:132143793-132143815 TGCCACGGTCCTGAGGCTGCAGG + Intronic
1076895359 10:133308829-133308851 TGCGCGGGGGCTGTGGCTCCGGG - Exonic
1077138197 11:1012065-1012087 TGCCTGTGTGCTGCGCCTGCAGG + Exonic
1077232087 11:1462288-1462310 AGCCCGGGTGCGGCGGCCGTGGG + Intronic
1077506921 11:2933845-2933867 TGCTCAGGTGCTGCAGCTCCAGG - Intergenic
1077877447 11:6320146-6320168 AGCCCAGGTGCAGCGGCTGGAGG - Exonic
1077888107 11:6401119-6401141 TGCCCTGCTGGTGGGGCTGCGGG - Intronic
1078987060 11:16607066-16607088 TGGCCGGGAGCCGCGGCTGCCGG - Intronic
1080873109 11:36254026-36254048 CTCCCAGGTGCTGCTGCTGCTGG + Intergenic
1081286638 11:41278665-41278687 TTCCTGGGTGATGCTGCTGCTGG + Intronic
1081710153 11:45211073-45211095 TGGCCGAGTGCTGCCGCAGCTGG - Intronic
1082942642 11:58724454-58724476 TGCCCAGATGCTGCAGATGCTGG - Exonic
1082996941 11:59262391-59262413 TCCCAGGGTGCAGCTGCTGCTGG + Intergenic
1083574850 11:63782889-63782911 TCCCCAAGTGCTGCGACTGCTGG - Intergenic
1083789518 11:64975522-64975544 TTCCCAGGTGCTGCTGCTGCTGG + Intergenic
1084839215 11:71831468-71831490 TTCCCGGATGGGGCGGCTGCCGG - Intergenic
1085258651 11:75191636-75191658 GGCCCTGGTCCTGCTGCTGCAGG + Intronic
1085443346 11:76582587-76582609 TTCCCGGATGGGGCGGCTGCCGG + Intergenic
1086459234 11:86989375-86989397 TCCAGGGCTGCTGCGGCTGCTGG - Intergenic
1090277486 11:125430092-125430114 TGCGGGGGTGCTGCAGCAGCAGG + Exonic
1091857882 12:3753604-3753626 TCCCGAGGTGCTCCGGCTGCAGG + Intronic
1094108768 12:26839257-26839279 TGGCCGGCTGCTCCGGGTGCGGG - Intergenic
1094497220 12:30995863-30995885 TTCCCAGGAGCTGCAGCTGCTGG + Exonic
1096154909 12:49336459-49336481 GGCCATGGTGCTGCTGCTGCTGG - Exonic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1097199825 12:57269002-57269024 GGCCCTGGTTCTGTGGCTGCTGG + Exonic
1098232959 12:68391379-68391401 TGCCCGGTCTCTGAGGCTGCAGG - Intergenic
1099790696 12:87330297-87330319 TGGCCGGCTGCTGCGAGTGCTGG - Intergenic
1101131792 12:101697756-101697778 CGGCCGGGTCCTGCGACTGCCGG - Exonic
1101962121 12:109258371-109258393 GGGCCGGGAGCTGTGGCTGCTGG + Intronic
1102970400 12:117161711-117161733 TGCCTGTCTGCTGTGGCTGCTGG - Intronic
1103164635 12:118759971-118759993 TGCCCTGCTGCTGCTACTGCTGG + Intergenic
1103471414 12:121184720-121184742 TGCCCAGCTGCTGCCGCTGGAGG + Exonic
1103521150 12:121537609-121537631 TGCCTGGGGGCTGCGGAGGCGGG + Intronic
1103719566 12:122966111-122966133 GGGCTGGGAGCTGCGGCTGCGGG + Intronic
1104614535 12:130256933-130256955 TGGCCGGCTGCTCCGGGTGCGGG + Intergenic
1104679028 12:130736653-130736675 TGACTGGTTGCTGCAGCTGCCGG + Intergenic
1105009341 12:132745031-132745053 TGCCCGGGAGCTGCCTCTGCTGG - Intronic
1105865946 13:24460003-24460025 TGCCAGGGTGCTACGGTGGCGGG + Exonic
1105866043 13:24460598-24460620 TGCCCTGGTTCTACAGCTGCTGG - Intronic
1106478090 13:30115017-30115039 TGCCTGGGCGCTGCGGCTCGCGG - Intergenic
1109897740 13:68715834-68715856 TGCCCAGGGGATGTGGCTGCTGG + Intergenic
1111424102 13:88057116-88057138 TGCCCAGGGGCTGCGGATGGGGG - Intergenic
1113078430 13:106491661-106491683 TGTCCGGGTGCCAGGGCTGCAGG - Exonic
1113412908 13:110106063-110106085 TGCCCTGATGCTCCCGCTGCTGG - Intergenic
1114536343 14:23425385-23425407 GGCCGGGCTGCTGGGGCTGCTGG - Exonic
1115119901 14:29927314-29927336 TGAGCCGGTGCTGCTGCTGCAGG - Exonic
1115217205 14:31025863-31025885 TGTGCGGGAGCTGCGGCGGCTGG - Intronic
1118347911 14:64953085-64953107 TGGCTGGGTGCTGAGGCTTCAGG - Intronic
1120173411 14:81269284-81269306 TGGCCGGGTGCTGTGGCTCATGG - Intronic
1120720749 14:87887707-87887729 TGCCCGGGTACTGTGCTTGCTGG - Intronic
1122979062 14:105182940-105182962 TGTCCCGGGGCTGCTGCTGCTGG - Intergenic
1123033497 14:105462114-105462136 TCTCGGGGGGCTGCGGCTGCGGG + Intronic
1202834433 14_GL000009v2_random:67367-67389 GGAGCAGGTGCTGCGGCTGCTGG - Intergenic
1123470941 15:20551515-20551537 TCCCGGGGTGCTGGGACTGCAGG + Intergenic
1123647117 15:22449185-22449207 TCCCGGGGTGCTGGGACTGCAGG - Intergenic
1123676051 15:22710986-22711008 TTCCGGGGTGCTGCGATTGCAGG + Intergenic
1123731244 15:23146503-23146525 TCCCGGGGTGCTGGGACTGCAGG + Intergenic
1123749382 15:23343918-23343940 TCCCGGGGTGCTGGGACTGCAGG + Intergenic
1124252570 15:28116688-28116710 TGCACGGGTGCTCTGGCGGCCGG + Exonic
1124281753 15:28367795-28367817 TCCCGGGGTGCTGGGACTGCAGG + Intergenic
1124300950 15:28543809-28543831 TCCCGGGGTGCTGGGACTGCAGG - Intergenic
1124328251 15:28784900-28784922 TTCCGGGGTGCTGCGATTGCAGG + Intergenic
1124500770 15:30225193-30225215 GGCCCGGGTGAGGCGGCGGCAGG - Intergenic
1124742800 15:32313474-32313496 GGCCCGGGTGAGGCGGCGGCAGG + Intergenic
1124973726 15:34514686-34514708 TGAGCGGGGGCTGCGGCTCCTGG + Intergenic
1125960631 15:43826915-43826937 TGCTCTGGCGCTGCGGCCGCTGG + Intergenic
1127683507 15:61319696-61319718 TTCCCACGTGCTGCTGCTGCTGG + Intergenic
1128314485 15:66652084-66652106 CGCCCAGGTGCTGAGGCAGCAGG + Intronic
1129144333 15:73633365-73633387 GGCCTGGGCGCTGCGGCGGCAGG - Exonic
1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG + Intronic
1130011106 15:80153436-80153458 TGCCTGTGTGCTGCAGCTTCCGG - Intronic
1130867208 15:87943161-87943183 TTCCCAGGTGCTGCTGGTGCAGG + Intronic
1131384740 15:91994871-91994893 TGCCTGGATGCTGCTGCTGTCGG + Intronic
1132551297 16:554865-554887 GGCCCTGGGGCTGCGGCCGCAGG - Intergenic
1132696258 16:1203357-1203379 CGCCTGTGTGCTGTGGCTGCTGG + Intronic
1134235421 16:12461531-12461553 GGCTCTGGTGCTGAGGCTGCAGG + Intronic
1136234481 16:28905459-28905481 GGCCAAGGTGCTGCGGCTGCAGG - Exonic
1136536903 16:30904783-30904805 TGCCCTGGTACTGGAGCTGCAGG + Intergenic
1136682821 16:31977910-31977932 TGCCCGGGTGCAGGGGCAGGTGG + Intergenic
1136783459 16:32921476-32921498 TGCCCGGGTGCAGGGGCAGGTGG + Intergenic
1137668091 16:50263327-50263349 TGGCTGGTGGCTGCGGCTGCGGG + Intronic
1138625723 16:58249959-58249981 TGCCCAGGAGCTCCGGGTGCCGG - Exonic
1138905926 16:61333155-61333177 TCCCCAGATGCTGAGGCTGCGGG - Intergenic
1139451365 16:67029891-67029913 GGCGCGGCTGCTGCGGCTCCCGG + Intronic
1139548224 16:67659740-67659762 GGGCCGGCTGCTGCTGCTGCAGG - Exonic
1142126504 16:88413252-88413274 TGGCTGGGTGCTGAGGCTGGCGG + Intergenic
1142133798 16:88442615-88442637 CGCCTGGGGGCTGCGTCTGCTGG - Intergenic
1142184069 16:88686178-88686200 TGCGCAGCGGCTGCGGCTGCAGG - Intronic
1142394918 16:89826845-89826867 TCCCAGGGTGCTGGGGTTGCAGG - Intronic
1142408947 16:89906553-89906575 TGAGCGCGTGGTGCGGCTGCTGG + Intronic
1203086109 16_KI270728v1_random:1185460-1185482 TGCCCGGGTGCAGGGGCAGGTGG + Intergenic
1142791081 17:2266602-2266624 TGCCAGGGTGCTGCTGAGGCTGG - Intronic
1142809351 17:2387899-2387921 TGACCGCGTGCTGCGGCAGACGG - Exonic
1143027951 17:3951976-3951998 TTCCCAGCTGCTGCTGCTGCTGG - Intronic
1143109309 17:4544580-4544602 TGCCCTGGTCCTGGAGCTGCTGG - Exonic
1143574310 17:7781192-7781214 TGACCGGGTGCTGTGGCTCATGG + Intronic
1144733405 17:17541474-17541496 TGCCCCGCTGCTGCTGCGGCCGG - Intronic
1146815555 17:35939254-35939276 GGCCCAGGTGCTGCAGCTGGAGG - Exonic
1147118776 17:38322620-38322642 AGCCTGGGTGATGAGGCTGCTGG + Exonic
1148383769 17:47220013-47220035 TGCCGAGGTGCTGCGTGTGCTGG + Exonic
1148634026 17:49133229-49133251 TGCCCGGGCGCGGGGACTGCGGG + Intronic
1150057371 17:62030511-62030533 GGCCAGAGTGCTGCCGCTGCAGG - Intronic
1150069737 17:62140441-62140463 GGCGCGGGTGCGGCAGCTGCAGG - Intergenic
1152068640 17:78124616-78124638 TGCCCTCCTGCTGCTGCTGCTGG - Exonic
1152068693 17:78124850-78124872 TGCCCTGGGGCTGGGGCGGCTGG - Intronic
1152256332 17:79242180-79242202 TCCCAGCGTGCTGCTGCTGCTGG + Intronic
1152718978 17:81913514-81913536 TGCCCGCGTGCTCCTGCTCCAGG - Intronic
1152753497 17:82077450-82077472 GGGCCTGGTGCAGCGGCTGCAGG - Intergenic
1153457589 18:5296488-5296510 AGGCCGGGCGCTGAGGCTGCGGG + Intronic
1154293067 18:13127426-13127448 TGTCCGGGTGCTGGGGATGCGGG - Intergenic
1154979345 18:21489713-21489735 CTCCCAGGTGCTGCTGCTGCTGG + Intronic
1158893592 18:61894323-61894345 GGGCCGGGTGCTGGGGCTGCAGG - Intergenic
1160131607 18:76230477-76230499 TGCCTGGTAGCTGCTGCTGCTGG - Intergenic
1160710513 19:549050-549072 GTCCCGGGTGCTGCGGGAGCTGG + Exonic
1160725421 19:616103-616125 GGCCCGGGTGAGGCGGCGGCAGG - Exonic
1160728605 19:630139-630161 GGCGCGGGTGCGGCAGCTGCAGG - Exonic
1160911334 19:1475148-1475170 TGCCCGCCTGCTGCAGCCGCTGG + Exonic
1161105747 19:2443223-2443245 TGCCCGGGGCCTGGGGCTCCAGG - Intronic
1161526640 19:4760053-4760075 TGCGCGGGGGCTGGGGCTGGGGG + Intergenic
1162759615 19:12880983-12881005 TGCTCCGGTACAGCGGCTGCAGG + Exonic
1162893083 19:13747995-13748017 GGCCAGGGTGAGGCGGCTGCCGG - Intronic
1163125962 19:15244369-15244391 TGCCTGGGAGCTGGGGCTCCAGG + Exonic
1164936985 19:32222866-32222888 TGCCAGGATGCTGCTGCTGCCGG - Intergenic
1164992183 19:32692399-32692421 GGCCCGGGTGCTGGGCCTGGTGG - Exonic
1165060670 19:33203859-33203881 AGCCCGGGTGCTTGAGCTGCAGG + Intronic
1165132334 19:33640855-33640877 TGCCCAGGTGTGGGGGCTGCTGG + Intronic
1165393280 19:35550395-35550417 TGCCCAGGCGCTGCTGCTCCAGG + Exonic
1165747507 19:38238784-38238806 TCCCCGGTAGCTGGGGCTGCAGG - Intergenic
1167229393 19:48272070-48272092 TGCCCGCATGCAGCGGTTGCAGG + Intronic
1167289422 19:48616152-48616174 TGCCCTGAGGATGCGGCTGCGGG + Exonic
1167331759 19:48860444-48860466 TGCCCGGGTGCTCTGCCTGCGGG + Exonic
1167456595 19:49599556-49599578 TGGCAGGGGGCTGGGGCTGCAGG - Exonic
1167467205 19:49656621-49656643 TGCCCCGAGCCTGCGGCTGCGGG + Intronic
1167571599 19:50292365-50292387 GGCTGAGGTGCTGCGGCTGCAGG + Exonic
1167577388 19:50324314-50324336 TGCCCATCTGCTGCGTCTGCTGG - Intronic
1167716292 19:51144587-51144609 TGCCGTGGTGCTGGGGCTGTGGG - Exonic
1168257747 19:55175870-55175892 TGCCTGGGCCCTGCAGCTGCTGG - Exonic
1168322618 19:55518869-55518891 TGCCCGGGGTCTGGGGCAGCTGG + Exonic
1168337725 19:55605759-55605781 GGCCCGGGTGCAGCGGGGGCGGG + Intronic
1168594516 19:57664504-57664526 AGACCCGGGGCTGCGGCTGCAGG + Intergenic
925070895 2:965638-965660 GGCTCGGGGGCTGCTGCTGCTGG + Intronic
926058937 2:9793270-9793292 TGTCCGGATGCAGCAGCTGCAGG - Intergenic
926185827 2:10689988-10690010 TGCCCGCGTGTTCCGGCTCCAGG - Intergenic
927256358 2:21043879-21043901 TGCGCTGCTGCTGCTGCTGCTGG - Exonic
928158941 2:28903775-28903797 TGCTCAGCTGCTGTGGCTGCTGG + Intronic
929023353 2:37575804-37575826 TGCCCAGGTGCTGTGGCTGGAGG - Intergenic
932764609 2:74461946-74461968 TGCCCGTGTGCTGACGCGGCTGG - Exonic
935634883 2:105242602-105242624 TGACCTGTTGCTGCCGCTGCAGG - Exonic
935848702 2:107195749-107195771 TGCCCGGGTGCTGTTAGTGCTGG + Intergenic
938290162 2:130144798-130144820 TCTCCGAGTGCTGCTGCTGCAGG + Exonic
938466367 2:131528147-131528169 TCTCCGAGTGCTGCTGCTGCAGG - Exonic
938629924 2:133155405-133155427 TTCCTGGGTGATGCGGATGCTGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
941005894 2:160246582-160246604 ATCCCTGGTGCTGCAGCTGCTGG + Intronic
942186783 2:173431740-173431762 CTCCCGGGTTTTGCGGCTGCTGG - Intergenic
942447546 2:176088116-176088138 TGCTCGAGAGCTGGGGCTGCAGG + Intergenic
944676063 2:202034695-202034717 TGCCCTGGTGCTGGCGCTGCTGG + Exonic
946767241 2:223051985-223052007 TGGCCGGGTGCTGGGGCTTGAGG + Exonic
947549834 2:231038033-231038055 GGCGCCGGGGCTGCGGCTGCTGG + Exonic
947736072 2:232456208-232456230 GCCCTGGGTGCTGCTGCTGCTGG + Exonic
947870715 2:233436390-233436412 TGGCAGTGTGCTGCGCCTGCAGG + Exonic
947984602 2:234437688-234437710 TGCCCGTGTCCTTTGGCTGCAGG + Intergenic
948168025 2:235878125-235878147 AGTATGGGTGCTGCGGCTGCTGG + Intronic
948699551 2:239751372-239751394 GGCACAGGGGCTGCGGCTGCTGG + Intergenic
949079769 2:242087949-242087971 GGCACGGGGGCTGCGGCTCCTGG + Intergenic
1169130802 20:3165577-3165599 GGCCCGGCTGATGCGGCAGCGGG - Exonic
1170889892 20:20368163-20368185 TGCCCGGGCGCGGCGGCTGCGGG - Exonic
1171484305 20:25476458-25476480 AGCCCGGGAGCTGCCTCTGCTGG - Exonic
1172155315 20:32820044-32820066 GGCCCGGGGGGTGCGGCTGGGGG + Intronic
1172389716 20:34558731-34558753 AGCACGGCGGCTGCGGCTGCGGG - Intronic
1172997799 20:39083768-39083790 TGCCCGGGAGGAGCAGCTGCTGG + Intergenic
1173322304 20:41999000-41999022 GGCCCGCCTGCTGCTGCTGCAGG + Intergenic
1173895292 20:46546183-46546205 TCCCTGGCTGCTGCTGCTGCAGG - Exonic
1174293218 20:49524066-49524088 GGCCCTGGTGCTGCAGCTGTGGG - Exonic
1174475756 20:50794852-50794874 TGCCCAGGTGCTGCGGGGGCGGG + Intergenic
1175012384 20:55752723-55752745 TTCTCAGGTGCTGCTGCTGCTGG - Intergenic
1175097292 20:56551733-56551755 TGCCAGGCTGCTCCTGCTGCGGG - Intergenic
1175756965 20:61536109-61536131 TGGCCGGGTTCTGTGCCTGCAGG - Intronic
1175872838 20:62216558-62216580 CGCCTGGCTGCTGGGGCTGCTGG - Exonic
1176107433 20:63395954-63395976 TGGCCGGGTGGAGGGGCTGCAGG + Intergenic
1176301827 21:5102244-5102266 TGCCCGCATGCAGAGGCTGCTGG + Intergenic
1178707828 21:34889554-34889576 TGTCCGGCTGCTGCGGGTGCCGG - Intronic
1179855204 21:44159656-44159678 TGCCCGCATGCAGAGGCTGCTGG - Intergenic
1179912384 21:44456977-44456999 GGCCGGGGGCCTGCGGCTGCTGG + Exonic
1179939068 21:44626744-44626766 AGCCCGTGTCCTGAGGCTGCTGG + Intronic
1180693608 22:17738184-17738206 TGCCCTGGAGCAGCTGCTGCAGG - Exonic
1180870012 22:19140650-19140672 TGCCCTGGTGCTGCGTGTGGTGG + Intronic
1181052155 22:20243075-20243097 GGCATGGGTGCTGTGGCTGCAGG - Exonic
1181456379 22:23062326-23062348 TGCCCGGCAGCTGCTGCTGTTGG - Intronic
1181630853 22:24150547-24150569 GGCCCGAGTGCTGTGGCTGCTGG + Intronic
1182222908 22:28772906-28772928 AGGCCGGCTGCGGCGGCTGCAGG - Exonic
1182524720 22:30908012-30908034 TGCCCTGATGCTGCGGCCACAGG + Intergenic
1182889880 22:33808833-33808855 TGCCCAGGTTCTGAGGCTGAGGG - Intronic
1183261429 22:36798236-36798258 GGCCCCTGCGCTGCGGCTGCAGG - Intergenic
1183361363 22:37384819-37384841 TGCCCAGGGGCTGCAGCTGAGGG - Intronic
1183834964 22:40444807-40444829 TGCCAGGGTGCTGGGGTTACAGG - Intronic
1183931213 22:41237265-41237287 TGCCCGAGAGCTGCAGCTCCAGG + Exonic
1184243983 22:43226763-43226785 TGTCTGGGTGCTGGGGCTGTGGG - Intronic
1184301545 22:43563657-43563679 TGCCGCGCTGCTGCTGCTGCTGG + Intronic
1184425741 22:44408278-44408300 TGACCGGGTGCAGCCTCTGCGGG - Intergenic
1184844580 22:47073478-47073500 TGCCAGCATGCTGAGGCTGCGGG + Intronic
1185296683 22:50058242-50058264 ACCCCCGGTGCGGCGGCTGCTGG + Intergenic
950335162 3:12187531-12187553 TGCCAGGGAGCTGCTGCTGGAGG - Exonic
950411522 3:12841065-12841087 GGCCCGAGGGCTGCTGCTGCGGG - Intronic
951981476 3:28571907-28571929 TTCCCAGGTGCTACTGCTGCTGG + Intergenic
953576076 3:44114157-44114179 TGCCTTTGTGCTGCTGCTGCCGG - Intergenic
954584206 3:51719951-51719973 TGTCCGGGTGCTGGGGTTGGTGG - Intergenic
954992655 3:54854571-54854593 AGCCTGGGTGCTGCGGCGCCTGG - Intronic
959889618 3:111539938-111539960 TGCCTGGGTCTTGCAGCTGCAGG + Intronic
960602111 3:119468931-119468953 CGCCCACGTGCTGCGGCTCCCGG + Exonic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
961331877 3:126147342-126147364 TGCCCGGGTGTTGTAGCAGCAGG + Intronic
961869410 3:129976931-129976953 TGCCTGGGTGCTGCCGCTTCGGG - Exonic
963113592 3:141707049-141707071 TCCCAGGGTGCTGATGCTGCTGG + Intergenic
963236842 3:142964028-142964050 GGGCGGGGAGCTGCGGCTGCGGG + Intergenic
963328552 3:143889058-143889080 CTCCCAGGTGCTGCTGCTGCTGG - Intergenic
963615275 3:147528735-147528757 TGCCATGCTGCTGCAGCTGCTGG - Intergenic
966800489 3:183759110-183759132 TGCCAGGGTACTGCGGTTACAGG + Intronic
968426526 4:527135-527157 TGCCCTGGCGCTGGGGCTGCTGG + Exonic
968565716 4:1311588-1311610 AGCCAGGCTGCTGCGGCTGCAGG - Intronic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
969216024 4:5723134-5723156 TCCCCAGGTGCTGCGCCTACAGG + Intronic
969310046 4:6347761-6347783 TGTCCTGGTGCAGCTGCTGCAGG - Intronic
969400495 4:6952307-6952329 TGCCCAGGCGATGCCGCTGCTGG + Intronic
970429308 4:15973948-15973970 TGCCCGGTTCCTGGGGCTGCTGG + Intronic
971234608 4:24829783-24829805 TGCTTGGGTGCAGCGGCTGGGGG - Intronic
975393963 4:73853570-73853592 TGCGCGCGTGCTGAGTCTGCGGG + Intronic
975683254 4:76896934-76896956 TGCGCTGCTGCTGCTGCTGCAGG + Exonic
982182870 4:152765396-152765418 TTCCCGGATGGGGCGGCTGCCGG + Intronic
982694616 4:158585054-158585076 TTCCCAGGTGATGCTGCTGCTGG + Intronic
983792238 4:171813049-171813071 AGCCGGGGCGCGGCGGCTGCGGG - Intronic
985145848 4:186893799-186893821 TGCACCAGTGCTGCTGCTGCAGG + Intergenic
985279474 4:188270967-188270989 TGCCAGGCTGCTGCTGCTGCTGG - Intergenic
985947179 5:3194908-3194930 AGCCTGGCTGCTGCTGCTGCAGG - Intergenic
986336925 5:6762325-6762347 TGCCCTGGGGCTACGTCTGCAGG - Intergenic
989355463 5:40539325-40539347 TGCCCGGGGCTTGCTGCTGCTGG + Intergenic
992072021 5:73157063-73157085 TTCCCAGGTGCTGCTGCTGCTGG + Intergenic
996221368 5:120936830-120936852 TGGGCGGGAGCTGGGGCTGCGGG + Intergenic
997582372 5:135026031-135026053 TTCCCCGCTGCTCCGGCTGCAGG - Intergenic
997669717 5:135660829-135660851 TCCCCGGGTGCTGCTGCTGCTGG + Intergenic
997889566 5:137663342-137663364 TGCCCTGGGGCTGGGGCTGGTGG - Intronic
998402340 5:141854228-141854250 TTCCGGGGGGCTGGGGCTGCCGG + Exonic
998511948 5:142721132-142721154 TGCCAGGTTGCTGCAGCTGCCGG - Intergenic
999256041 5:150210514-150210536 AGCCAGGGTGCTGGGGCTGCGGG + Exonic
1001397862 5:171429589-171429611 TGGCCCGATGCTGCTGCTGCTGG + Intronic
1001419203 5:171573976-171573998 TGTCCGGGTGGCCCGGCTGCCGG - Intergenic
1001746718 5:174098215-174098237 TGTCAGGGTGCTGGGGCTGGAGG + Intronic
1002322315 5:178383203-178383225 TTCCTAGGTGCTGCGGCTACTGG + Intronic
1002640637 5:180629074-180629096 TGTCCGGCTGCCGGGGCTGCAGG - Intronic
1003645552 6:7910698-7910720 TGCGCTGCTGCTGCTGCTGCTGG - Exonic
1004705781 6:18122480-18122502 TGCGCGGGCGCCGCTGCTGCCGG + Exonic
1006272423 6:32974502-32974524 TTCCCTGGTGCTGCTGCTTCTGG - Exonic
1011723837 6:90187947-90187969 TGCCCCAGTGCTGAGGCTACGGG + Intronic
1012742311 6:103033579-103033601 TGACCGGATGGTGTGGCTGCAGG + Intergenic
1012815634 6:104018796-104018818 GGCCCTGGTTCTGTGGCTGCTGG + Intergenic
1014028210 6:116672749-116672771 TTCCCTGGTTCTGAGGCTGCTGG + Intergenic
1017684789 6:156901444-156901466 GGTGCGGGGGCTGCGGCTGCTGG - Exonic
1018748022 6:166777466-166777488 TGCCTGGGTTCTGGGGCTCCTGG - Intronic
1019317033 7:391578-391600 GGCCCGGGTGCTGCCGCAGGAGG + Intergenic
1019361385 7:605916-605938 TGCCCCCGGGCTGCGACTGCTGG - Intronic
1021101112 7:16586622-16586644 TGCCTGGGGCCTTCGGCTGCGGG - Intergenic
1022972411 7:35530163-35530185 TCCTCGGGTGCTGGGGGTGCTGG - Intergenic
1023165825 7:37342881-37342903 TGCCTGGGTGCTGAAGGTGCAGG + Intronic
1024609961 7:51055652-51055674 TTCCCAGGTGTTGCTGCTGCCGG + Intronic
1027624263 7:80528193-80528215 TGGCCTGGTGCTGGGGCTGATGG - Intronic
1029237592 7:99133970-99133992 TGCCAGGGGGGTGCGGCTGAGGG + Intronic
1031964458 7:128017669-128017691 TCCCCGAGTGGTGCTGCTGCTGG - Intronic
1032156873 7:129476292-129476314 TTCCCAGATGCGGCGGCTGCCGG + Intronic
1032187755 7:129741877-129741899 TGCCAGGCTGCTGCTGCTGTTGG - Intronic
1033294087 7:140114971-140114993 TTCCCGGATGGGGCGGCTGCCGG - Intronic
1034274829 7:149819509-149819531 TGCCCAGGTGAGGCGGCTGGGGG + Intergenic
1034549567 7:151811680-151811702 TGCCGGGCTGCTGAGGCTTCAGG + Intronic
1034558223 7:151863175-151863197 TCCCCGGGTGCAGGGGGTGCTGG + Intronic
1035132974 7:156673033-156673055 TTCCCAGGAGCTGAGGCTGCGGG + Intronic
1035276514 7:157751139-157751161 TCCCTTGGTCCTGCGGCTGCAGG - Intronic
1035537818 8:406234-406256 GGCACGGGGGCTGCGGCTCCTGG + Intergenic
1037155575 8:15694903-15694925 TGCCAGACTGCTGCTGCTGCTGG - Intronic
1037263861 8:17037095-17037117 TGGCCGGCTGCTCCGACTGCGGG + Intronic
1037340411 8:17838812-17838834 TTCCCAGGTGCTGCTGCTGCTGG + Intergenic
1038828564 8:31033214-31033236 TGCCCGGCTGCTCCGGCGGGGGG - Exonic
1039479311 8:37860020-37860042 TGCCTGGCTTCTGCTGCTGCTGG - Exonic
1040711085 8:50189444-50189466 TTCCCAGGTGCTGCTGATGCAGG + Intronic
1042598267 8:70472160-70472182 TGCCCTGGTGCTGCAGAAGCAGG + Intergenic
1044629165 8:94262317-94262339 CGCCCGGCCGCGGCGGCTGCAGG - Exonic
1045240176 8:100393435-100393457 TGGCCGGGTGCTGTGGCTCACGG - Intronic
1045489393 8:102656882-102656904 CGCCCGTGTGCTGCGCCTGGGGG + Intergenic
1046836328 8:118805774-118805796 TGTCCAGATGCTGCTGCTGCTGG + Intergenic
1049006829 8:139860943-139860965 AGCCTGGGAGCTGTGGCTGCCGG + Intronic
1049218197 8:141417386-141417408 TGCCCGGGCGGTGGGGCTGGTGG + Intronic
1049740923 8:144240477-144240499 TCCCCATGTGCTGTGGCTGCAGG - Intronic
1050094254 9:2047330-2047352 GGCCCGGGCACTGCGGCCGCGGG - Exonic
1052872732 9:33523965-33523987 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1053351461 9:37416112-37416134 TTCCCGGGTGATGCTGCTGCTGG - Intergenic
1056052253 9:82781384-82781406 TTCCCAGGTGATGCTGCTGCTGG - Intergenic
1056475098 9:86945888-86945910 TGCCCGGGCGCGGTGGGTGCGGG + Exonic
1056732567 9:89178485-89178507 CGCCCGGGCGCTGCTGGTGCCGG + Exonic
1057181803 9:93034648-93034670 TCCCCAGGTGCTGCACCTGCAGG + Exonic
1057259709 9:93576784-93576806 TGCCCGTGTACTGCGTCTGCCGG + Exonic
1057596145 9:96417725-96417747 TGCTCGGCGGCTGCGGCTGCAGG + Exonic
1057684722 9:97221861-97221883 TGCCCCGGTGCAGCCGCCGCGGG + Intergenic
1060629557 9:125143401-125143423 TCCGCGGCTGCTGGGGCTGCCGG + Exonic
1061263785 9:129494219-129494241 CCCCAGGGTGCTGCGGCAGCTGG - Intergenic
1061505718 9:131030828-131030850 TGCCCAGGTACTGATGCTGCTGG - Intronic
1061570463 9:131474910-131474932 TGCCCGTCTGCTCCGGGTGCTGG - Exonic
1061869552 9:133513455-133513477 TGCCCGTGAGCAGAGGCTGCAGG - Intergenic
1062319691 9:135984683-135984705 GTCCCGGGTTCTGTGGCTGCAGG + Intergenic
1202800565 9_KI270719v1_random:170878-170900 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1185642007 X:1593570-1593592 TCCCCGGCTGCTTCAGCTGCGGG - Exonic
1187396603 X:18924705-18924727 TGCCCGGGAGCTGTCGCTGTAGG + Intronic
1189323163 X:40098089-40098111 CGCCCGAGCGCTGCGCCTGCGGG - Intronic
1189348805 X:40262129-40262151 AGCCAGGCTGCTGCTGCTGCAGG - Intergenic
1190533921 X:51407654-51407676 TACCAGGGTGATGCGGCTTCGGG - Exonic
1190692178 X:52920973-52920995 TGCTCGGCTGCTGTGGTTGCGGG + Intergenic
1192382787 X:70635775-70635797 TGCCTGGATCCTGGGGCTGCAGG - Intronic
1192510296 X:71717232-71717254 TGCTCAGGAGCTGCTGCTGCAGG - Exonic
1192516401 X:71764321-71764343 TGCTCAGGAGCTGCTGCTGCAGG + Exonic
1193890007 X:87033274-87033296 TTCCCGGATGGGGCGGCTGCTGG + Intergenic
1196574380 X:117301730-117301752 TGCCATGGTACTGTGGCTGCTGG - Intergenic
1200053067 X:153444939-153444961 GGCCCGGGTGCCGTGGCTGTGGG + Exonic
1200099910 X:153685201-153685223 GGCCCGGGGGCAGCAGCTGCTGG - Intronic
1200277863 X:154751162-154751184 TCCCCGGGGGCCGCGGCGGCCGG - Intronic