ID: 1096779038

View in Genome Browser
Species Human (GRCh38)
Location 12:53981814-53981836
Sequence GTGAGCAATGCAGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 531}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096779038_1096779043 -2 Left 1096779038 12:53981814-53981836 CCCTCCTCCTCTGCATTGCTCAC 0: 1
1: 0
2: 6
3: 61
4: 531
Right 1096779043 12:53981835-53981857 ACAGCCCCACAGACAGAAGGAGG 0: 1
1: 0
2: 4
3: 27
4: 351
1096779038_1096779042 -5 Left 1096779038 12:53981814-53981836 CCCTCCTCCTCTGCATTGCTCAC 0: 1
1: 0
2: 6
3: 61
4: 531
Right 1096779042 12:53981832-53981854 CTCACAGCCCCACAGACAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 430
1096779038_1096779051 27 Left 1096779038 12:53981814-53981836 CCCTCCTCCTCTGCATTGCTCAC 0: 1
1: 0
2: 6
3: 61
4: 531
Right 1096779051 12:53981864-53981886 CCCGTCCTTGTTGCCTTTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096779038 Original CRISPR GTGAGCAATGCAGAGGAGGA GGG (reversed) Intergenic
901120088 1:6884175-6884197 GGGAGCAAGGCTGAAGAGGAAGG + Intronic
901661361 1:10799810-10799832 GTGAACCAGGCAGAGAAGGAGGG - Intergenic
901770255 1:11526550-11526572 GTGAACTATGCCGAGGAGGGAGG + Intronic
901870675 1:12137414-12137436 GTGAGTAATTCAGAGGAGGCAGG - Intronic
902219484 1:14955825-14955847 CTGAGCACTGCACAGGAGGGAGG - Intronic
902421870 1:16287127-16287149 GTGAACAAAGGAGAGGAGGTTGG - Intronic
902844018 1:19095367-19095389 GTGAGCCAGCCAGAGGAGAAGGG + Intronic
902965195 1:19995979-19996001 GTGATCAATGCAGAAGATGGTGG + Intergenic
903310002 1:22447719-22447741 ATGACAAATGCCGAGGAGGAGGG - Intergenic
904679806 1:32221485-32221507 GGGAGGAGTTCAGAGGAGGAAGG - Intronic
905403672 1:37719585-37719607 GTGATCAAGGCTGTGGAGGATGG - Exonic
905458230 1:38103299-38103321 GTGAGAAAGGCAGTGGAGAAGGG + Intergenic
905557668 1:38899922-38899944 GGCAGAAAAGCAGAGGAGGACGG - Intronic
905824342 1:41017440-41017462 GTGAGCAATGCTGAGCAGCCTGG - Intronic
906467858 1:46100400-46100422 GTGAGCATTGAAGATGAGTAAGG - Intronic
906732409 1:48094319-48094341 GTCAGCAGTGCTGCGGAGGAGGG - Intergenic
906806447 1:48783363-48783385 AATAGCAATGCAGAGGGGGAAGG + Intronic
908210315 1:61893896-61893918 GTGGAAAATGGAGAGGAGGAAGG + Intronic
908839722 1:68266800-68266822 GAGAGTAATGCTCAGGAGGATGG - Intergenic
908921768 1:69202873-69202895 GTGAGAAACGTAGAGGAGCATGG - Intergenic
909075270 1:71045643-71045665 CAGAGCAATGCAGAGGAGCAAGG - Intronic
909308384 1:74112348-74112370 TTAAGCAATTAAGAGGAGGATGG + Intronic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
910866722 1:91795127-91795149 GTGAGCAACGCAGAGCCAGATGG + Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911657381 1:100460529-100460551 GTGAGGAATGGGGAGGAGAAGGG - Intronic
913009378 1:114668250-114668272 TTCAGCAATTCAGTGGAGGATGG - Intronic
914044965 1:144083749-144083771 GTGAGCAAGGGAGGGGAGGAGGG + Intergenic
914133145 1:144876937-144876959 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
914850786 1:151312561-151312583 GTGAGCTGTGCTGTGGAGGACGG - Intronic
915573421 1:156758897-156758919 GGCAGCAGTGCAGAGGTGGAAGG + Intronic
915687205 1:157645506-157645528 TTGTGCAGTGCAGAGCAGGAAGG + Intergenic
916412316 1:164558937-164558959 GTGAGGAAAGTAGGGGAGGAGGG + Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
918346178 1:183609301-183609323 GTGAGGAGGGCAGAGGAGAAAGG + Intergenic
918690869 1:187477713-187477735 ATTTGCAATGCAGAGGAGAAAGG - Intergenic
918786212 1:188768332-188768354 GAGAGCAAGGCAAAGCAGGATGG + Intergenic
919654625 1:200185420-200185442 ATGAGCAATGCAGAAGACGGGGG + Intergenic
919907508 1:202087992-202088014 GTGAGAAATGAAGAAGAGGGAGG + Intergenic
920699597 1:208207832-208207854 GTGAGCTGCACAGAGGAGGAAGG + Intronic
920750480 1:208669940-208669962 GTGAGGAAGGCACAGGAGGTAGG + Intergenic
921166729 1:212513378-212513400 CTGAGCAATGCAGAGGGGTGAGG + Intergenic
922466577 1:225848942-225848964 GTGAGCCAGGCAGACCAGGATGG + Exonic
923233569 1:232011071-232011093 GTGGGCAGGGCAGAGAAGGAGGG - Intronic
923425603 1:233865799-233865821 GTGAGCAAGGAAAAGGAGGTAGG - Intergenic
923669276 1:236026135-236026157 GTGATCACTGCAGAGTGGGAAGG + Exonic
924104127 1:240633741-240633763 GTAAGAAATGAAGAGGAAGAAGG + Intergenic
924316003 1:242797372-242797394 GAGAGAAATACAGGGGAGGAAGG - Intergenic
1062842486 10:681818-681840 CTGAGCTCTGAAGAGGAGGAAGG - Intronic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1063988867 10:11537743-11537765 GTGAGCACTGCCGGGGTGGAAGG + Intronic
1064600054 10:16984513-16984535 GCCAGAATTGCAGAGGAGGACGG + Intronic
1064757269 10:18582428-18582450 GTGAGCAATTAAGAGGAGGCTGG + Intronic
1066603598 10:37137290-37137312 GTGAGCAACGCAGAAAGGGATGG + Intronic
1066957091 10:42183431-42183453 GTGAGCAAGGGAGGGGAGGAGGG + Intergenic
1067043469 10:42970734-42970756 GTCAGCTAAGCAGAGCAGGAAGG - Intergenic
1067075655 10:43179821-43179843 GTAAGCAATTAAGAGGAGGCTGG - Intronic
1067705479 10:48603939-48603961 GTAAACAATGAAGTGGAGGATGG - Intronic
1067721936 10:48734023-48734045 GTGAGGAATGCAGGTAAGGATGG + Exonic
1068522202 10:58089904-58089926 GCTAGCAATGCAAAGGAGGGGGG - Intergenic
1068577273 10:58698386-58698408 GTGTCCCAGGCAGAGGAGGAGGG - Intronic
1069220624 10:65878778-65878800 TAGAGCATTGCAGAGCAGGATGG + Intergenic
1069627515 10:69877309-69877331 GTCAGTGATGCAGAGGAGGCTGG - Intronic
1069889385 10:71643785-71643807 GAGAGGTATGGAGAGGAGGAAGG - Intronic
1070001183 10:72378671-72378693 TGGAGCAATGCAGAGGAGCAAGG + Intronic
1070683084 10:78462722-78462744 GTGGACAATGCCGTGGAGGAAGG - Intergenic
1071091196 10:81920438-81920460 GTGATCAATGCTTAGAAGGAAGG - Intronic
1072063915 10:91846518-91846540 GTGCCCAAAGCAGAGGTGGAAGG - Intronic
1072662591 10:97371805-97371827 GTGAGCCAGGCAAAGGAGCATGG + Intronic
1072825505 10:98602095-98602117 GTGAGTGATGCTGAGGAGTAAGG + Intronic
1073454276 10:103627169-103627191 GTGAGCACTTCTGAGGAGCAGGG - Exonic
1074059817 10:109954754-109954776 ATGAGCCAAGCAGAGGAGGCTGG + Intergenic
1074276891 10:112011913-112011935 GTGGGCAAGGTAGAGGAGAATGG - Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075914780 10:126157845-126157867 ATGAGCAAAGGAGAGGAAGAGGG + Intronic
1076223198 10:128751420-128751442 GTGAGCTATGCAGAAGTGGAGGG + Intergenic
1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG + Intergenic
1076502066 10:130945060-130945082 GTGAGCAAAGAAGAGGAGACAGG - Intergenic
1076738043 10:132467494-132467516 GTGAGCTGAGCAGGGGAGGAGGG + Intergenic
1076932273 10:133539838-133539860 GTGTGCACTGCTGAGGAGAATGG + Intronic
1077118439 11:895966-895988 GTGGCCACTGCAGGGGAGGACGG - Intronic
1077300357 11:1843907-1843929 GTGAGGAATGGAGACGTGGAAGG + Intergenic
1077523822 11:3052046-3052068 GTGAGCAATGAAGAAAAAGAGGG - Intronic
1078051277 11:7967072-7967094 GTTAGAAATGCAGAAGAGAAAGG + Intergenic
1078531365 11:12139213-12139235 AGGAGCAGGGCAGAGGAGGAGGG - Intronic
1080175622 11:29359362-29359384 AAGAGCACTGCAGATGAGGATGG - Intergenic
1080381638 11:31777779-31777801 GTAAGCAATTCAGAGTGGGAAGG - Intronic
1080399608 11:31921891-31921913 GTGAGCAACCCAGAGGAGAAAGG - Intronic
1080916347 11:36664374-36664396 GTAAGCCATGGTGAGGAGGACGG - Intergenic
1081729795 11:45362614-45362636 GGGAGCAATGCAGAGAATCAAGG - Intergenic
1082797784 11:57390435-57390457 ATGTGCAAGGCAGAGGATGAAGG + Intronic
1083593267 11:63907457-63907479 CTGGGGATTGCAGAGGAGGAAGG - Intronic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1084725433 11:70938825-70938847 GTGAGCACGGCAGAGAAGGGAGG + Intronic
1085516202 11:77113234-77113256 GTCAGCCAGGCAGAGGCGGATGG - Intronic
1085645173 11:78218151-78218173 GTGAGCAGTGCAGTGGAAGTCGG - Exonic
1086067998 11:82766795-82766817 GGGAGCAAAGGAGGGGAGGATGG + Intergenic
1086235091 11:84620201-84620223 GTGAGCATTGCAGATAAGTAAGG + Intronic
1087289126 11:96300406-96300428 GTGCCCATTGCAAAGGAGGAGGG + Intronic
1088695347 11:112361507-112361529 GGGAGCATTGCTGTGGAGGAGGG + Intergenic
1089007984 11:115108535-115108557 GTCAGCGATGCAGAGGAGCCAGG + Intergenic
1089491909 11:118889146-118889168 GTGAGCACTGGGGAGGAGCAGGG - Intronic
1089858844 11:121571233-121571255 GTGAACCAAGCAGAGGTGGAGGG + Intronic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090408135 11:126489658-126489680 GTGGGGAATGCAGAGGGGAAGGG - Intronic
1090459269 11:126875552-126875574 GTGAGCAAGGCAGAGGAGTCTGG + Intronic
1090619532 11:128548987-128549009 GGGAGGATTGCAGGGGAGGAAGG + Intronic
1091312873 11:134586898-134586920 GTGAGGGCTGCACAGGAGGAAGG + Intergenic
1091675883 12:2488948-2488970 GTGGGCAGTGCAGACAAGGAGGG + Intronic
1091724391 12:2835326-2835348 GGGAGGGATGCAGAGGAGGGCGG - Intronic
1091808922 12:3378843-3378865 GTGAGCAAGGGAGAGAAGGAAGG - Intergenic
1093535482 12:20218092-20218114 GTGAGTAATGGAGACGAGGGAGG + Intergenic
1093850034 12:24025181-24025203 GAGAGCAAAGTTGAGGAGGATGG + Intergenic
1094218054 12:27965981-27966003 GAGAGCAATACAGAAGACGAGGG - Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1094496152 12:30990607-30990629 GGGAGGGATGGAGAGGAGGAAGG + Intronic
1096125664 12:49117650-49117672 GTGAGCAGTGAAGAGGATGGTGG + Intergenic
1096691901 12:53326542-53326564 GTGAGAAAAGGAGAAGAGGAAGG - Intergenic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097502454 12:60422184-60422206 GTGAGGAAGGAAGGGGAGGAAGG - Intergenic
1098053941 12:66483812-66483834 GTGAGCAATGTAAAGGAGTAGGG - Intronic
1098073549 12:66701240-66701262 GGCAGCTATGAAGAGGAGGAAGG - Intronic
1098827703 12:75318492-75318514 GAGAGCAAGGGAGAGAAGGAAGG - Intronic
1099467564 12:83005904-83005926 AAGAGCCATGCAGAGGAGCATGG + Intronic
1101247046 12:102893490-102893512 GAAAGCAATACAGAGGAAGAAGG - Intronic
1101646795 12:106638456-106638478 GTTAGCAATGCAATGGAGCAGGG - Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101789023 12:107911511-107911533 GGGACTAATGCACAGGAGGAGGG - Intergenic
1101791061 12:107928156-107928178 GTGAGCTATGAAGGGGAGGTGGG - Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1102287948 12:111674568-111674590 GTGAGCTAAGCAGCTGAGGAAGG + Intronic
1102785960 12:115605009-115605031 GTGGGCAATGCATAGATGGATGG + Intergenic
1102813446 12:115843478-115843500 GTGAGCAGTGCAAGGGAAGAAGG + Intergenic
1103248929 12:119483200-119483222 GTGTGCAAAGCAGAGAGGGATGG + Intronic
1103798700 12:123523164-123523186 GTGTGCTGTGCAGAGGAGAAAGG - Intronic
1104521517 12:129480193-129480215 GTGTGCAAGGGAGAGGAAGAAGG + Intronic
1105052056 12:133063566-133063588 GTGAGCAATGCAGGGTTGTAAGG - Intergenic
1105070776 12:133233158-133233180 GTGGCCACTGCAGAGGAGGCTGG + Intronic
1105581364 13:21699576-21699598 GAGAGCAAAGGAGAGGAGAAAGG - Intronic
1105824528 13:24110280-24110302 GTGAGGAAGGGAGGGGAGGATGG + Intronic
1106563102 13:30863422-30863444 GTGGGCAAGGCAGAGCAGGCAGG - Intergenic
1106580077 13:31010192-31010214 ATGAGCAAGGCATTGGAGGAAGG - Intergenic
1107355190 13:39558984-39559006 ATGAACAAAGCAGAGTAGGAGGG + Intronic
1109194959 13:59368655-59368677 GCAATCAGTGCAGAGGAGGAGGG - Intergenic
1109263056 13:60165754-60165776 ATGAGCTAAGCAGAGGAGGTTGG + Intergenic
1109594878 13:64538274-64538296 ATGAGCCAAGCAGAGGAGGTTGG - Intergenic
1110526481 13:76543997-76544019 GTGAGCAATTAAGAGGAAGGTGG + Intergenic
1111719105 13:91918882-91918904 GAGGGAAATGCAGAGAAGGAGGG - Intronic
1113076817 13:106475163-106475185 GTGAGTCATGCCGAGGAGGGAGG - Intergenic
1113431735 13:110256384-110256406 GTGAAGACAGCAGAGGAGGATGG + Intronic
1113438535 13:110311133-110311155 GTGGGAGAAGCAGAGGAGGAAGG - Intronic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1114066778 14:19066790-19066812 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
1114095488 14:19333237-19333259 ACCAGCAAGGCAGAGGAGGAGGG + Intergenic
1114203352 14:20543933-20543955 GTGAGGGATGGAGAGGATGAGGG - Intergenic
1114370048 14:22076832-22076854 GTAAGCAATTAAGAGGAGGCTGG - Intergenic
1115853418 14:37604805-37604827 ATGAGAAGGGCAGAGGAGGAAGG - Intronic
1116160279 14:41259001-41259023 GTGAGCAAGGGAGATGGGGAAGG + Intergenic
1116809212 14:49523413-49523435 GAGGGCAATGCAGAAGAGGGAGG - Intergenic
1117074747 14:52090761-52090783 GTGAGGGATGCAGGGAAGGAAGG + Intergenic
1118714258 14:68548068-68548090 GGGAGGGAGGCAGAGGAGGAAGG + Intronic
1118733913 14:68688963-68688985 CTGAGCATGGCTGAGGAGGAGGG + Intronic
1118843509 14:69529098-69529120 GTGAGCTCACCAGAGGAGGAGGG - Exonic
1118901060 14:69986244-69986266 GTGAGGAATGGGGTGGAGGAGGG + Intronic
1120022628 14:79547929-79547951 TTTAACAATGCAGGGGAGGAGGG + Intronic
1120486873 14:85125092-85125114 GCCAGCTAGGCAGAGGAGGAGGG + Intergenic
1121285083 14:92728986-92729008 GTCAGCACTGCAGAGCAGGTGGG + Intronic
1121665189 14:95666741-95666763 GTGTGCAATGCAGTGTGGGAAGG + Intergenic
1121890942 14:97590000-97590022 GTGAGCAAGAGAGAGGAGTAGGG + Intergenic
1122299937 14:100725745-100725767 GGGAGCTCTGCAGAGGAAGAGGG + Intronic
1122359822 14:101152559-101152581 GTGAGCAATGTAGGGGAGCGTGG + Intergenic
1122416350 14:101551439-101551461 GTGAGCCATGGAGAGAAAGAGGG - Intergenic
1202936018 14_KI270725v1_random:88345-88367 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
1123429369 15:20201934-20201956 GTCAGCAGAGCAGAGGAGGGTGG - Intergenic
1123578931 15:21698798-21698820 GTCAGCAGTGCTGCGGAGGAAGG + Intergenic
1123615558 15:22141280-22141302 GTCAGCAGTGCTGCGGAGGAAGG + Intergenic
1124784223 15:32664310-32664332 GAGAGCAATGTAGGGAAGGAGGG - Intronic
1124801036 15:32833051-32833073 AAGAGCAGAGCAGAGGAGGAGGG - Intronic
1125071321 15:35557219-35557241 GAGAACAAGGCAGAGGATGAAGG + Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125364946 15:38903594-38903616 GTGAGGAATGCCTGGGAGGAGGG - Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125762013 15:42103258-42103280 GAGAGAAATGAATAGGAGGAAGG - Intergenic
1126186082 15:45831570-45831592 GGGAGGAAAGGAGAGGAGGACGG - Intergenic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1126411111 15:48374104-48374126 GGGAGAAATGGGGAGGAGGAGGG - Intergenic
1126981495 15:54249350-54249372 TTAAGCAGAGCAGAGGAGGAGGG + Intronic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127264421 15:57349998-57350020 TTGTGGAATTCAGAGGAGGAAGG + Intergenic
1128389612 15:67174210-67174232 GTGATCAGTGCATGGGAGGAAGG - Intronic
1128513355 15:68327044-68327066 GTGAACACCGCAGATGAGGAGGG + Intronic
1128581338 15:68812321-68812343 GTGTGCAATGCACTGAAGGATGG + Intronic
1128714385 15:69896722-69896744 CTATGCAATCCAGAGGAGGAGGG + Intergenic
1129270110 15:74415060-74415082 GGGAGGGATGGAGAGGAGGAAGG + Intronic
1129556220 15:76512580-76512602 GTCAGCACTGCAGAAGTGGAGGG + Intronic
1129602809 15:77010077-77010099 GTGACTGATGCAGGGGAGGATGG - Intronic
1129704496 15:77786576-77786598 GTAGGCCATGCAGAGGAGGGAGG + Intronic
1129847011 15:78772640-78772662 GTGACCAGTGCAGTGGAGGGAGG - Intronic
1130254890 15:82321251-82321273 GTGATCAGTGCAGTGGAGGGAGG + Intergenic
1130459973 15:84153618-84153640 GGGAGAAAGGGAGAGGAGGAGGG + Intergenic
1130600084 15:85268755-85268777 GTGATCAGTGCAGTGGAGGGAGG - Intergenic
1130627196 15:85527601-85527623 ATGAGCATTTTAGAGGAGGAAGG - Intronic
1130819575 15:87480163-87480185 GTAGGCAATGCAGAGATGGAAGG - Intergenic
1131065835 15:89434478-89434500 GTGAGCAAAGCTGATGAAGAGGG + Intergenic
1131172675 15:90189863-90189885 GTGAGCAGTGCAGCAGAGCAGGG - Intronic
1131265510 15:90912992-90913014 GTGAGCCCTGCATATGAGGAAGG + Intronic
1131818261 15:96245338-96245360 GAGAGAAATGCAGTGGCGGAGGG - Intergenic
1202987801 15_KI270727v1_random:433043-433065 GTCAGCAGTGCTGCGGAGGAAGG + Intergenic
1133381568 16:5335453-5335475 ATGTGCAATGGAGAAGAGGAAGG - Intergenic
1133381585 16:5335585-5335607 ATGTGCAATGGAGAAGAGGAAGG - Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1135328692 16:21543842-21543864 GTGGGCAGTGCAGGGCAGGACGG - Intergenic
1135947176 16:26875415-26875437 GTGAGCATTGCCAAGGAAGAAGG - Intergenic
1136339043 16:29629815-29629837 GTGGGCAGTGCAGGGCAGGACGG - Intergenic
1136565008 16:31064549-31064571 GTGAGAAATGCAGATGAGATAGG - Intronic
1136854951 16:33647795-33647817 GTCAGCAGAGCAGAGGAGGGTGG + Intergenic
1137538004 16:49342121-49342143 GTGCGCAAAGAAGATGAGGAGGG + Intergenic
1138628570 16:58274294-58274316 GTAAGCAATTTAGAGGAGGCTGG - Intronic
1138774121 16:59700255-59700277 GTGAGCAAGGGAGTGGAGGAGGG - Intergenic
1139108659 16:63861817-63861839 GTGGCCAAAGGAGAGGAGGAAGG + Intergenic
1139140480 16:64256105-64256127 GTTAGCAATGCTGAGGTTGAGGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1140756326 16:78070758-78070780 GTGAGCCAAGCAGAGGAGGCTGG - Intergenic
1141151038 16:81564964-81564986 GTGGGCATTGCAGGGCAGGAGGG + Intronic
1141891784 16:86930944-86930966 GAGAGGGATGAAGAGGAGGAGGG - Intergenic
1142313217 16:89326331-89326353 GCTGGGAATGCAGAGGAGGACGG + Intronic
1203116529 16_KI270728v1_random:1496280-1496302 GTCAGCAGAGCAGAGGAGGGTGG + Intergenic
1142754382 17:2007274-2007296 GTGGGTGATCCAGAGGAGGAAGG - Intronic
1142972361 17:3621490-3621512 GGGAGGAATGGAGAGAAGGAAGG - Intronic
1143707514 17:8709166-8709188 GTGGGCACTTCAGAGCAGGAAGG + Intergenic
1144029317 17:11305379-11305401 ATAAGCAATGCACAGGAAGAGGG + Intronic
1144700147 17:17332277-17332299 GTGAGCCACGCGGAGCAGGAAGG + Intronic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146055581 17:29579148-29579170 AAGAGCAAGCCAGAGGAGGAGGG - Intronic
1146511492 17:33453118-33453140 GTGAGAATTGCAGAGGAGGAAGG - Intronic
1147862373 17:43531039-43531061 GTGAGCTGGGGAGAGGAGGAGGG - Intronic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1148689566 17:49519615-49519637 GGTAGCAGTGGAGAGGAGGAGGG - Intergenic
1148694056 17:49548623-49548645 GTGACCAACACAGAGTAGGAGGG - Intergenic
1150227402 17:63531446-63531468 TTGAGCAATGCAGAGCATGGAGG + Intronic
1150235150 17:63586910-63586932 GTCATCTATGCAGAGGGGGATGG - Intronic
1150455739 17:65305159-65305181 GTGAGCACTGCAGGGAAGGAGGG + Intergenic
1151025977 17:70677635-70677657 GTGAGCATTTAAGATGAGGAGGG + Intergenic
1151184061 17:72350668-72350690 ATGAGCAACGCTGGGGAGGAAGG + Intergenic
1152988157 18:338110-338132 GTGGAAAATACAGAGGAGGATGG - Intronic
1154031682 18:10758717-10758739 GTTACAAATGCAAAGGAGGATGG - Intronic
1154192029 18:12237731-12237753 CTGAACAATGCAGAAAAGGAAGG + Intergenic
1154306527 18:13234498-13234520 GTGAGCAGGCCAGGGGAGGATGG + Intronic
1155215066 18:23635920-23635942 GTGGGGAATGGAGAGGAGGGAGG + Intronic
1155641847 18:28026987-28027009 ATGACCACTGCAGGGGAGGAGGG - Intronic
1156087837 18:33429334-33429356 GGGAGAAAAGCAGAGAAGGAGGG + Intronic
1156109174 18:33703150-33703172 GTGAGCAATTAAGAGGAGACTGG - Intronic
1156193280 18:34744644-34744666 GGGAGGAATGCAGAGGAGATAGG + Intronic
1156455986 18:37294450-37294472 GTGACCCATGCATAGGAGCAGGG - Intronic
1156515720 18:37678476-37678498 GTGAACAATGATGAGGAGAAAGG + Intergenic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1156840754 18:41607256-41607278 GTGAGAATGGCAGATGAGGATGG - Intergenic
1157221373 18:45830427-45830449 GTGACCAATCTAAAGGAGGAAGG - Intronic
1157256607 18:46145185-46145207 GTTTGGAATGCAGAAGAGGAAGG + Intergenic
1159344145 18:67176677-67176699 TTGAGCAAAGCAGAGGAAGTGGG + Intergenic
1159557626 18:69961907-69961929 ATGTGGAATGCAGAGGAGAAAGG - Intergenic
1160980674 19:1815307-1815329 GAGAGCCCCGCAGAGGAGGACGG + Exonic
1161562605 19:4981722-4981744 GAGAGCACTGCAGAGCAGGTGGG - Intronic
1161657772 19:5526321-5526343 GAGGGCAATGGAGAGGAGAAGGG + Intergenic
1161766191 19:6210255-6210277 GTGACCAAAACAGAGAAGGAGGG - Intergenic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1162319224 19:9960901-9960923 GAGGGCAAGGCAGAGGATGAGGG + Intronic
1163466775 19:17472429-17472451 GTGCGCAATGCTCAGGAGTATGG - Intronic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1165827526 19:38713818-38713840 GTGAACAGTGTAGAGGAGGCAGG - Intronic
1166181896 19:41114506-41114528 GTGAGGGAGGCAGAGAAGGAGGG + Intronic
1166515131 19:43440806-43440828 GTGAGCAATGGAAAGAAGGCTGG + Intergenic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167231943 19:48290534-48290556 GGAAGGAATGAAGAGGAGGAGGG + Intergenic
1167634411 19:50646061-50646083 GAGAGAGATGCAGAGGAGGAGGG + Intronic
1167682467 19:50932455-50932477 GTGTGGAATGCAGGGGGGGAGGG + Intergenic
1167967148 19:53157378-53157400 GAGAGCTATGTAGAGGATGAGGG - Intronic
1168237465 19:55072211-55072233 GTTAGCAATGGCGAGGACGATGG - Intronic
1168251605 19:55145448-55145470 GTGAGAAAGGCAGAGATGGAGGG - Intronic
1168502703 19:56906779-56906801 GAGTGGAATGCAGAGCAGGAAGG + Intergenic
1202684523 1_KI270712v1_random:37153-37175 GTGAGCAAGGGAGGGGAGGAGGG + Intergenic
925318719 2:2944727-2944749 GTGAGCTATGCAAAGAAGCAAGG + Intergenic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
927129980 2:20051019-20051041 GGGAGCACTGGATAGGAGGAAGG + Intronic
927493932 2:23539958-23539980 ATGAGGATTACAGAGGAGGATGG - Intronic
928029831 2:27768702-27768724 GCCAGCACAGCAGAGGAGGAGGG + Intergenic
928156908 2:28885143-28885165 GTGAGCGATGCTGGGGAGGTTGG + Intergenic
928656837 2:33461004-33461026 GAAATCAATGCAGAGGAGCATGG - Intronic
929582106 2:43087931-43087953 ATGGGCAAGGCAGAAGAGGAGGG + Intergenic
929592155 2:43154358-43154380 GACAGAAAGGCAGAGGAGGACGG + Intergenic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930907687 2:56592320-56592342 GTGAGCAAAGGAGAGGAAGAGGG + Intergenic
931242535 2:60466285-60466307 TTGAGCAGTTCAGAGGAGGGTGG - Intronic
931862722 2:66373254-66373276 GGGAACAATGGAGAGGAGGAAGG - Intergenic
931975685 2:67641616-67641638 CTAAGGAATGCAGGGGAGGAAGG + Intergenic
932476068 2:72006692-72006714 ATGCTTAATGCAGAGGAGGATGG - Intergenic
934247196 2:90317693-90317715 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
934262131 2:91484910-91484932 GTGAGCAAGGGAGGGGAGGAGGG + Intergenic
934305181 2:91815896-91815918 GTGAGCAAGGGAGGGGAGGAGGG + Intergenic
934328076 2:92036852-92036874 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
934466463 2:94267391-94267413 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
934901313 2:98162113-98162135 GTGTGCCATGCAGAGGTGCACGG - Intronic
935493786 2:103752961-103752983 GTCAGCAATTAAGAGGAGGCTGG + Intergenic
935493976 2:103755124-103755146 GTAAGCAATTAAGAGGAGGCTGG + Intergenic
937395805 2:121533563-121533585 GTGAGCCATGCAGAAGAAGTTGG - Intronic
938484176 2:131686885-131686907 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
938653567 2:133408456-133408478 GTCAGCAATGTAGAGGGGGTAGG - Intronic
938846899 2:135219348-135219370 GTGAGCCAAGAAGAGGAGGCAGG + Intronic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
940209704 2:151243877-151243899 ATGAGCTATGCAGAGAAGGTTGG - Intergenic
940267970 2:151860133-151860155 GTGAGCAGGGCTGTGGAGGATGG - Intronic
941918664 2:170828571-170828593 GTGAGGACAGCAGAGGAGGACGG - Intronic
942335345 2:174878646-174878668 CTGAGCCATGCAGGGCAGGATGG + Intronic
942492580 2:176504818-176504840 CTGAGCTATCCAGAGGAGCAGGG + Intergenic
943623685 2:190177374-190177396 GTGAGGACTGGAGAGGGGGATGG - Intronic
943821778 2:192332430-192332452 GTGAGAAATGGAGAGCAGAAAGG - Intergenic
943928356 2:193818783-193818805 GTGAGCAATACACAGGCAGAAGG - Intergenic
945813344 2:214574237-214574259 AAGAGCCATGCAGAGCAGGAGGG - Intronic
945874891 2:215267814-215267836 GAAAGCAATCCAGAGGAAGAGGG - Intergenic
946553076 2:220823811-220823833 GGGAGGAAGGAAGAGGAGGAAGG - Intergenic
946933699 2:224697403-224697425 TTCAGCATTGCAGAGTAGGAAGG - Intergenic
947018256 2:225645475-225645497 GAGAGAAAGGCAGTGGAGGAGGG - Intronic
948034884 2:234850398-234850420 AGGAGCAAGACAGAGGAGGAAGG + Intergenic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948544390 2:238716753-238716775 GTGAGAGGTGGAGAGGAGGAGGG + Intergenic
1168840429 20:906663-906685 AGAAGCAAGGCAGAGGAGGAGGG - Intronic
1169303528 20:4468338-4468360 GTAAGGAATGCAGCAGAGGATGG + Intergenic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1170505946 20:17025948-17025970 GTAAGCAATACAGAGTGGGAGGG + Intergenic
1170736805 20:19019978-19020000 GTTAGCCAGGCAGAGGAGGGAGG + Intergenic
1171146787 20:22791502-22791524 GTCAGAAATGCTGAGGAGCAGGG + Intergenic
1171328514 20:24317526-24317548 GGGAGCAAGGCAGAGGAGGAAGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172060790 20:32186015-32186037 GAGAGCAAAGCAGAAGTGGATGG + Intergenic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1173440063 20:43068015-43068037 GGGAGGAAGGAAGAGGAGGAAGG + Intronic
1173601456 20:44298545-44298567 GTGAGCAAAGCTAAGGACGAAGG - Intergenic
1173929152 20:46804077-46804099 GGGAGAAAGGCAAAGGAGGAAGG + Intergenic
1174045488 20:47729843-47729865 TATAGCATTGCAGAGGAGGACGG + Intronic
1174311664 20:49660617-49660639 ATGAGCATTGCACAGGAGAAGGG - Intronic
1174784160 20:53417083-53417105 GAGAGTCATGCAGGGGAGGAGGG - Intronic
1175009909 20:55724601-55724623 GCGAGCACTTCAGAGAAGGAAGG - Intergenic
1175503419 20:59466149-59466171 GTGATCAATGAAGAGAAAGAAGG + Intergenic
1175882940 20:62271069-62271091 GTGGGCAAAGCAGAGGCAGAGGG - Intronic
1175987000 20:62769009-62769031 GAGAGCAAGGCAGACGAGGAGGG + Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1177600441 21:23304012-23304034 GTGAGCAACTAAGAGGAGGCTGG - Intergenic
1178517905 21:33264269-33264291 GTGAGCAGTGGAGAGAAGGGGGG + Exonic
1180070862 21:45435278-45435300 GGGAGGAAGGAAGAGGAGGAAGG + Intronic
1180094752 21:45550845-45550867 GGGAGGAAGGCAGAGGAGGGAGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180280366 22:10688025-10688047 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
1180485260 22:15789374-15789396 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
1180587588 22:16906562-16906584 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
1180613749 22:17114267-17114289 GAGAGCCATGCAGAGGTGGAGGG - Exonic
1180729647 22:17971945-17971967 GTGAGAGAGGAAGAGGAGGATGG + Intronic
1180946232 22:19695299-19695321 GCGAGCAGTGCAGAAGAGGCGGG + Intergenic
1181346073 22:22221513-22221535 GGGAGCAATGAGGACGAGGAAGG - Intergenic
1182005607 22:26956983-26957005 GAGAGAAAGGCAGAGGAGAAGGG - Intergenic
1182087400 22:27570762-27570784 GTGTTCAAGGCAGAGGAAGAAGG - Intergenic
1182550991 22:31100627-31100649 GTGTGCAATGCAGACAAGGGTGG - Intronic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1183273942 22:36879517-36879539 GTGGGCACTGGAGTGGAGGACGG - Intergenic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1184226015 22:43129186-43129208 GGGAGCAAAGCAGAGGAGTCAGG - Intronic
1184629292 22:45763269-45763291 GTGTTCAAGGCAGAGAAGGAAGG + Intronic
1185097979 22:48822006-48822028 GCGAGGAAGGGAGAGGAGGAAGG - Intronic
1185345491 22:50308775-50308797 GTGGGGGAAGCAGAGGAGGAGGG - Intergenic
949744049 3:7267987-7268009 GTGACCAGTGCAGAGCAGCAAGG - Intronic
950020350 3:9782968-9782990 GTGATCAATGCAGAACAAGATGG + Intronic
950124708 3:10504367-10504389 GAGAGCAATGCAGGAGAGGAGGG + Intronic
950672306 3:14534664-14534686 GTGTGCAAGTCAGGGGAGGAGGG + Intronic
950964145 3:17134442-17134464 CTGACAAATGGAGAGGAGGAAGG - Intergenic
952061424 3:29515654-29515676 GTAAGCAATCCAGAGCAGTAGGG + Intronic
952428951 3:33203371-33203393 GTGAGCCATGAAGAGGATGCAGG - Intronic
953175981 3:40552447-40552469 GTGAGCTATGGAGATGGGGATGG + Intronic
953563376 3:44011999-44012021 ATCAGCAAACCAGAGGAGGAAGG - Intergenic
953806036 3:46067919-46067941 GTGGGAAAGGCAGAGGAGGGAGG + Intergenic
954084304 3:48231911-48231933 CAGGGCAATGCAGAGGAGGCAGG - Intergenic
954219060 3:49141588-49141610 GTGAGTGAGGCATAGGAGGAGGG - Intergenic
955044112 3:55343788-55343810 GAGACCAATGCAGTGGTGGAGGG - Intergenic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956697429 3:71930471-71930493 TGCAGGAATGCAGAGGAGGAAGG - Intergenic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
956916327 3:73875566-73875588 CTGAGGATTGCAGAGGGGGAGGG + Intergenic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
958446154 3:94217537-94217559 GTGACAAATGAAGAGGAGGAAGG + Intergenic
961510283 3:127396616-127396638 GGGAGGAATGCAGAGGGGGCGGG + Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961640800 3:128363698-128363720 GTGTGCCATGCAGAAGGGGATGG + Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962334748 3:134517148-134517170 GAGAGCAAGGCAGAGAAGGAAGG - Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
963261300 3:143193815-143193837 ATGATCAAAGCTGAGGAGGAGGG - Intergenic
964074535 3:152677200-152677222 GGGAACAATACAAAGGAGGATGG + Intergenic
965620991 3:170642151-170642173 GTGGTCAATTCAGAAGAGGAGGG - Intronic
966655178 3:182348690-182348712 GGGAGGAAAGCAGGGGAGGAAGG - Intergenic
967068321 3:185940026-185940048 GTGAGGAGTGGAGAGGAGGAGGG - Intergenic
967629447 3:191728069-191728091 GACAGCAAGGCAGAGGAAGAAGG - Intergenic
968887583 4:3343158-3343180 GTTACCACTACAGAGGAGGAGGG - Intronic
969337491 4:6520219-6520241 GGGAGATGTGCAGAGGAGGAGGG + Intronic
969664348 4:8548481-8548503 GGGAACAAGGCAGCGGAGGAGGG + Intergenic
969709933 4:8836939-8836961 GTGAGCACTGCAGGGTGGGAAGG + Intergenic
970425349 4:15940791-15940813 GTGTGCCAGGCAGAGAAGGAAGG - Intergenic
971375059 4:26049815-26049837 GTGAGAGAGGCAGATGAGGAGGG - Intergenic
975288493 4:72648589-72648611 GATAGCGATGCAGAGGAAGACGG + Intergenic
975624715 4:76334043-76334065 CTGAGCAAGACAGAGGAAGATGG - Exonic
977667019 4:99653804-99653826 ATGAACAAAGCAGAAGAGGATGG - Exonic
977877788 4:102169433-102169455 GGTAGAAATGCAGGGGAGGAAGG - Intergenic
978091540 4:104723076-104723098 GTCATCATAGCAGAGGAGGAAGG + Intergenic
978285080 4:107067778-107067800 GTGTGCAATGGAGAGGGGGCAGG + Intronic
979074137 4:116250170-116250192 TTGAGCAATGCAGAGGAAGCTGG - Intergenic
979640220 4:123004385-123004407 GTGAGCAACGCAGAAGATGAGGG - Intronic
980445264 4:132897906-132897928 TTGAACAATGCAGAGGATAAGGG - Intergenic
982122764 4:152158359-152158381 ATCAATAATGCAGAGGAGGAGGG + Intergenic
983041233 4:162930126-162930148 GTGAGCAAGGAAGAAAAGGAGGG + Intergenic
983606589 4:169593552-169593574 GTAAGCAAAGCAGAGAAGAAAGG + Intronic
986133161 5:4949238-4949260 GTAAAAAATGCAGAGGAGGAGGG + Intergenic
987045374 5:14102621-14102643 GTAAGCAATTAAGAGGAGGCTGG + Intergenic
988962117 5:36380766-36380788 GTGAGCGATGCAGAGGATGCTGG + Intergenic
990166052 5:52994359-52994381 TTTAGCTATGCAGAAGAGGATGG - Intronic
991046903 5:62232370-62232392 GTCAGCAGAGCAGAGGAGGGTGG - Intergenic
991966449 5:72096243-72096265 GTGAACATTGCAGAGGGTGAGGG + Intergenic
992215237 5:74519048-74519070 GTGGGCACTGGAGAAGAGGAAGG - Intergenic
992442158 5:76806446-76806468 GGGAGCTATGAAGAGGAGGATGG - Intergenic
993684578 5:90922558-90922580 GTGACCACTGTAGAGGAAGAAGG - Intronic
994190746 5:96866958-96866980 GTGAGGCAGGCAGAGAAGGAGGG - Intronic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
994353415 5:98770543-98770565 GTGAGCAATGCACTCGCGGAGGG - Intronic
995080766 5:108048143-108048165 GGGAGCAAAGCAGATGAAGAGGG + Intronic
995181751 5:109236328-109236350 GTGAACAAAGCAGATGAGGTGGG - Intergenic
995254455 5:110030474-110030496 GTCAGCAATGGAGAGGGGAAAGG - Intergenic
995376924 5:111484293-111484315 GTGCCCAAGGCAGTGGAGGATGG + Exonic
996140859 5:119907133-119907155 ATGAGCAGAGCAGAGGAGGTGGG - Intergenic
997918441 5:137952978-137953000 GTGAGGGATGGAGTGGAGGAGGG - Intronic
997995720 5:138584432-138584454 GAGAGCTCTGCAGAGGAGGGAGG + Intergenic
998559108 5:143154629-143154651 GTGATCAGTGAAGAGGAGGAAGG + Intronic
999231698 5:150065606-150065628 TGGGGCAAGGCAGAGGAGGATGG + Intronic
999605416 5:153308851-153308873 GTAAGCAATTGAGAGGAGGCTGG - Intergenic
1000064555 5:157683532-157683554 GTGAGGAGGGGAGAGGAGGAGGG - Intergenic
1000283873 5:159809245-159809267 ATGAAGAATGCAGAGTAGGAGGG + Intergenic
1000996431 5:167963708-167963730 GAGAGCAATGCAGAGAGGAAAGG - Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001516498 5:172358844-172358866 GTCAGCACTGCCGAGGAGCAAGG - Exonic
1001541606 5:172543359-172543381 ATGAGGGATGCTGAGGAGGAAGG + Intergenic
1002294823 5:178224455-178224477 GTCAGCAGTGCACAGGAGAAGGG - Exonic
1003354179 6:5350559-5350581 GAAAGCAATTCAGTGGAGGAAGG + Intronic
1003595917 6:7474058-7474080 GTGGGCCAGGCAGAGGAGAAAGG + Intergenic
1004058863 6:12170870-12170892 GGAAGTAATGCAGAGGAGGGTGG + Intergenic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1004772116 6:18795801-18795823 GTGAGCAGGACAGAGGAGGGAGG + Intergenic
1004782617 6:18928061-18928083 GAGAGAAATGCAGAGCAAGATGG - Intergenic
1004808928 6:19238489-19238511 ATCAGCAATTCAGAGGAGGCTGG + Intergenic
1006381687 6:33701952-33701974 GTCAGCAAGGAAGAGGAGGCAGG + Intronic
1006937497 6:37728605-37728627 ATGAGGGAGGCAGAGGAGGAAGG + Intergenic
1006956447 6:37877583-37877605 CTGAGCAATCCAGTGGATGATGG + Intronic
1007141120 6:39575691-39575713 CTTAACACTGCAGAGGAGGAGGG + Intronic
1007181662 6:39933437-39933459 TTGAGCAATATAGGGGAGGAGGG + Intronic
1007261228 6:40564795-40564817 GTGGGCAATGCTGGGGAGGTAGG - Intronic
1007323136 6:41041360-41041382 GTGTGGAAGGCAGAGGAGGGTGG - Intronic
1007590159 6:43016232-43016254 GTGTGCAATGCAAAGGGGAAGGG - Intronic
1010092955 6:72006398-72006420 GTGAGCAACGCAGAAGATGAAGG + Intronic
1010107173 6:72183059-72183081 GTGAGCAGCTCTGAGGAGGAGGG + Exonic
1010191752 6:73203220-73203242 GTGAGTCAAGCAGAGGAGGCTGG + Intergenic
1011029710 6:82908777-82908799 GTAAGTTATGCAGTGGAGGAAGG - Intronic
1011213626 6:84981329-84981351 TGGAGAAATGCAGAGGATGAGGG + Intergenic
1012696030 6:102384838-102384860 GTGAGAAATTAAGAGGAGTATGG - Intergenic
1015297182 6:131609211-131609233 GGAGGCAATGCAGAGGAGAATGG - Intronic
1015387943 6:132647512-132647534 GGGAGGAAAGGAGAGGAGGAGGG + Intergenic
1015851618 6:137579701-137579723 GTGAGCTTTCCAGAGGAGCATGG + Intergenic
1016276518 6:142359499-142359521 GTGAGCCAAGTAAAGGAGGAAGG - Intronic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017534121 6:155328340-155328362 GGGAGGAATGCAGAGGATAAAGG + Intergenic
1018992842 6:168687166-168687188 GGGAGCACAGCAGGGGAGGAGGG - Intergenic
1019030007 6:169001798-169001820 ATGGGGCATGCAGAGGAGGAGGG + Intergenic
1019533543 7:1515769-1515791 GTGAGCAATGGTGGAGAGGAGGG + Intergenic
1019855276 7:3599717-3599739 GTGAAAAATTCAGTGGAGGAGGG - Intronic
1019935580 7:4255204-4255226 GTGAGGAATGAAGAGGAAGCTGG - Intronic
1022041271 7:26583804-26583826 GTGAGCACTGCAAAGCAGGACGG - Intergenic
1022322543 7:29300379-29300401 GTGAGCTAGGGAGAGGAGGGTGG + Intronic
1022536642 7:31102556-31102578 GTGGGCCAGGCAGGGGAGGAAGG - Intronic
1022723995 7:32964617-32964639 GAGAACGCTGCAGAGGAGGAAGG - Intronic
1023031287 7:36092496-36092518 GGGAGCAAAGCAGAGGATGAGGG - Intergenic
1023938067 7:44753932-44753954 GAGAGCAATTCAAAGGAGGAAGG - Intronic
1023974263 7:45016172-45016194 GTAGGCACTTCAGAGGAGGAGGG + Intronic
1023994890 7:45153334-45153356 GGGAGCAGGGCAGAGGGGGATGG + Intergenic
1024471224 7:49770322-49770344 CTGAGCAATGCAGAGCAAGTGGG - Intergenic
1025049619 7:55723298-55723320 GAGAACGCTGCAGAGGAGGAAGG + Intergenic
1025094008 7:56083892-56083914 GGGAGAAAAGCAGAGGAGGCTGG + Intronic
1025187186 7:56870510-56870532 GTGGGCCATGGAGAGGAAGAAGG + Intergenic
1025684736 7:63706407-63706429 GTGGGCCATGGAGAGGAAGAAGG - Intergenic
1026461331 7:70617703-70617725 GTGACCGAGGGAGAGGAGGAAGG + Intronic
1027235452 7:76295062-76295084 GTGGGCAATGAAGAAGGGGAAGG + Intergenic
1027504815 7:79003071-79003093 CTGAGCTAAGCAGGGGAGGAAGG - Intronic
1028741886 7:94284879-94284901 GTGGGGAATGCAGAGTAGGTGGG - Intergenic
1029135540 7:98368048-98368070 GTGAGGATTGGTGAGGAGGAGGG - Intronic
1029222646 7:99002657-99002679 GTGAGGAATGCAGAGGAGGGAGG + Intronic
1029386250 7:100245530-100245552 CTGAGCAAGGCAGAGGGGCAGGG - Intronic
1030316435 7:108119601-108119623 GTTAGGAAGGCAGAGGGGGAGGG + Intronic
1031177095 7:118367418-118367440 TTGAGAAATTCAGAGGAAGATGG - Intergenic
1031353384 7:120762506-120762528 GTAAGGCATGCAGAGGAGGAGGG + Intergenic
1032060111 7:128716998-128717020 GTGAGCAATGCAGATGAGAATGG + Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033938237 7:146616229-146616251 GTGAGCAAAGCAAAGGATCACGG + Intronic
1034356090 7:150451559-150451581 GTGAGCCCTGAAGAGGAGGAGGG + Intronic
1034480583 7:151317348-151317370 GTGAGCAAGGAAGAAGAGAATGG - Intergenic
1034724220 7:153320275-153320297 GTAAGGAAAGCAGAAGAGGAAGG - Intergenic
1035050177 7:155994212-155994234 GTGTGTACAGCAGAGGAGGAGGG - Intergenic
1035237760 7:157509509-157509531 GAGAGCAATGGAGATGGGGAGGG + Intergenic
1035660770 8:1346232-1346254 GAGAGCAATGCAGATGTGTACGG - Intergenic
1035660774 8:1346281-1346303 GAGAGCAATGCAGATGTGTATGG - Intergenic
1035660779 8:1346330-1346352 GAGAGCAATGCAGATGTGTATGG - Intergenic
1035660794 8:1346478-1346500 GAGAGCAATGCAGATGTGTATGG - Intergenic
1035660803 8:1346576-1346598 GAGAGCAATGCAGATGTGTATGG - Intergenic
1035660833 8:1346919-1346941 GAGAGCAATGCAGACGTGTATGG - Intergenic
1035660877 8:1347359-1347381 GAGAGCAATGCAGATGTGTATGG - Intergenic
1035715634 8:1752286-1752308 GTGGACAAAACAGAGGAGGAGGG + Intergenic
1036689855 8:10938351-10938373 GTGAGCGATGCAGAAGACGGGGG - Intronic
1038084292 8:24176122-24176144 GTAAGGAATGGACAGGAGGAAGG - Intergenic
1038211029 8:25519258-25519280 GTGAGCAAGGCATAGGATGCTGG - Intergenic
1038406341 8:27325511-27325533 GTTAACAACTCAGAGGAGGAGGG + Intronic
1039954779 8:42198636-42198658 GTGAGCAAGCTAGAGGAGGAGGG + Intronic
1040001631 8:42581959-42581981 GGGAGCAAGGCAGAGGGAGAAGG - Intergenic
1040027866 8:42797880-42797902 ATGAGCTAAGCAGAGGAGGCTGG - Intergenic
1041778991 8:61557220-61557242 GAGTGCAATGCAGCAGAGGAGGG - Intronic
1041820982 8:62032706-62032728 GTGAGAAATGCACAGGAGGTCGG - Intergenic
1043314875 8:78908087-78908109 GTGAGCAATGCAAAGGACTGGGG + Intergenic
1044152696 8:88800979-88801001 CAGGGCAATGCAGAGGGGGAAGG + Intergenic
1044781133 8:95744532-95744554 GTGAACAAGGCAGATGGGGAAGG + Intergenic
1044991386 8:97799345-97799367 GTGAGCTAAGCAGAGGAGCTTGG + Intronic
1045314040 8:101027837-101027859 GTGGGCCATGCAGCTGAGGACGG + Intergenic
1045496370 8:102712736-102712758 GTGGGCTATGCAGAGGTTGATGG + Intergenic
1046403342 8:113737690-113737712 GTGAGTTATGCAGAGGGGAATGG - Intergenic
1046804044 8:118460683-118460705 GGGAGAAGTGCAGAGGAGAAGGG + Intronic
1047252496 8:123191520-123191542 GTGGGGAGTGCAGAGGAGGAAGG - Intronic
1047425565 8:124742430-124742452 GTGAGCAAGCAAGAGGAGGCTGG + Intergenic
1047438952 8:124859301-124859323 ATGAGCTAAGCAGAGGAGGTAGG + Intergenic
1048021451 8:130543220-130543242 GGGAGTAATGTAGAGGAGAAGGG - Intergenic
1048344168 8:133564365-133564387 GTGAGCTGAGCAGAGGAGGTTGG - Intronic
1048460402 8:134616566-134616588 GTCAGCAATTCAGAGGAAGCAGG - Intronic
1048829655 8:138463797-138463819 CTGAGCAATCCTGAGGAGAAGGG + Intronic
1048866948 8:138768257-138768279 GTGAGCAAGACAGATGGGGAGGG - Intronic
1049514347 8:143045550-143045572 GTGAGAATTGCAGGGAAGGATGG - Intronic
1049776227 8:144406656-144406678 GGCAGCAGTGCAGAGCAGGAGGG - Intronic
1049994844 9:1025139-1025161 GTGAGCATTGTGGAGGAGGCAGG + Intergenic
1050922650 9:11224756-11224778 GAGAGTAAGACAGAGGAGGAAGG + Intergenic
1050960805 9:11727929-11727951 GTGTACATTGCAAAGGAGGATGG + Intergenic
1051261958 9:15273456-15273478 GGGAGGAATGTGGAGGAGGAGGG - Intronic
1051681381 9:19611327-19611349 GGGGGCAAAGCAGGGGAGGAAGG + Intronic
1052051301 9:23851553-23851575 GTGAGAAGTGAAGAGGATGAAGG - Intergenic
1053372798 9:37576486-37576508 GGGAGGAAGGCAGACGAGGAGGG + Intronic
1053696509 9:40644162-40644184 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054307760 9:63443390-63443412 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1054440114 9:65252865-65252887 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054490291 9:65769074-65769096 ATGAGCAAGGGAGGGGAGGAGGG + Intergenic
1055043596 9:71901700-71901722 GAGAGGAATGAAGAGGGGGATGG - Intronic
1055679027 9:78695514-78695536 GGGAGGAAAGAAGAGGAGGAAGG + Intergenic
1055731424 9:79282659-79282681 ATTAGTGATGCAGAGGAGGAAGG + Intergenic
1056215847 9:84405225-84405247 GTGAGCAAGATAGAGGAGCATGG - Intergenic
1056774000 9:89498243-89498265 GTGAGCAGGGGCGAGGAGGAGGG - Intergenic
1057387121 9:94614150-94614172 GGGAAGAAGGCAGAGGAGGAAGG + Intronic
1057741926 9:97719535-97719557 GTGAGCAAGGCAGGGAAGCAGGG + Intergenic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1059003236 9:110373043-110373065 GTGAGAGATGCTGAGCAGGAAGG + Intronic
1059489095 9:114652491-114652513 GTGAGGAATGCATAGGACAAGGG + Intergenic
1059903042 9:118950239-118950261 GAGAGAAATGGAAAGGAGGAAGG + Intergenic
1061271621 9:129547007-129547029 GAGAGGAATGGAGAGAAGGAAGG + Intergenic
1061680428 9:132240330-132240352 GAGAGCCAGGGAGAGGAGGAGGG - Intronic
1062151653 9:135022445-135022467 ATGAGAAAGGCCGAGGAGGAAGG - Intergenic
1062316890 9:135971763-135971785 GTGGGCAGTGCAGAGAAGGGTGG + Intergenic
1062406529 9:136399515-136399537 GTGAGCAATGATCAGCAGGAAGG + Intergenic
1062709949 9:137969841-137969863 GTGTGCAATGCAGATAAGGAGGG - Intronic
1202778957 9_KI270717v1_random:17822-17844 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1203586028 Un_KI270747v1:4231-4253 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic
1185939071 X:4294061-4294083 GGAAGCAAGGAAGAGGAGGAGGG - Intergenic
1186491178 X:9973928-9973950 GTGAGCCCTGCAGATGAAGACGG + Intergenic
1186565339 X:10656342-10656364 GTGGGCATTGAAGAGGAGGGAGG - Intronic
1189067350 X:37824560-37824582 GTGAGAAATGGAGAGAATGATGG - Intronic
1189672095 X:43422350-43422372 ATAAGCAATGCAGAGGATGGAGG - Intergenic
1189751557 X:44227846-44227868 GTGTGCCATGCAGAGGATGGTGG + Intronic
1189793028 X:44621355-44621377 GGGAGCAAAGCAGAGAAGGACGG - Intergenic
1190628071 X:52355737-52355759 GAAAGCAACACAGAGGAGGAAGG - Intergenic
1190649586 X:52556023-52556045 GAAAGCAAGACAGAGGAGGAAGG + Intergenic
1190683774 X:52852242-52852264 GAAAGCAAGACAGAGGAGGAAGG + Intergenic
1190735772 X:53255281-53255303 GAGAGAAAGGCAGAGAAGGAAGG + Intronic
1193746542 X:85289025-85289047 GAGAGCAATTAAGAGGAGGCTGG + Intronic
1195002366 X:100654294-100654316 GTTAGCAATGATGAGGGGGAGGG + Intronic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1197150170 X:123211829-123211851 GAGAGAAATGCAGAGGAAGAGGG - Intronic
1197359868 X:125487646-125487668 ATGGGCAATGCAGTGGAGAAAGG - Intergenic
1197593158 X:128434187-128434209 TTGGGCATGGCAGAGGAGGAAGG - Intergenic
1197630129 X:128848793-128848815 GTGAGCCTTTCAGAGGAAGAAGG - Intergenic
1197979543 X:132200702-132200724 TTTAGCACTGCAGAGGATGAGGG + Intergenic
1201194254 Y:11476095-11476117 GTGAGCAAGGGAGGGGAGGAGGG - Intergenic