ID: 1096779049

View in Genome Browser
Species Human (GRCh38)
Location 12:53981863-53981885
Sequence CTGGAAAGGCAACAAGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096779049_1096779068 13 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779068 12:53981899-53981921 GGGAAGGGAGAAAGGGGCCAGGG 0: 1
1: 1
2: 9
3: 137
4: 1402
1096779049_1096779074 30 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779074 12:53981916-53981938 CCAGGGCATTGGCCCTGGGTGGG 0: 1
1: 0
2: 3
3: 35
4: 317
1096779049_1096779061 -2 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779061 12:53981884-53981906 AGGATCTGGGTACCCGGGAAGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1096779049_1096779063 6 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779063 12:53981892-53981914 GGTACCCGGGAAGGGAGAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 246
1096779049_1096779058 -7 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779058 12:53981879-53981901 TTTCCAGGATCTGGGTACCCGGG 0: 1
1: 0
2: 3
3: 13
4: 151
1096779049_1096779069 19 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779069 12:53981905-53981927 GGAGAAAGGGGCCAGGGCATTGG 0: 1
1: 1
2: 3
3: 67
4: 588
1096779049_1096779062 5 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779062 12:53981891-53981913 GGGTACCCGGGAAGGGAGAAAGG 0: 1
1: 0
2: 4
3: 17
4: 330
1096779049_1096779057 -8 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779057 12:53981878-53981900 CTTTCCAGGATCTGGGTACCCGG 0: 1
1: 0
2: 0
3: 13
4: 175
1096779049_1096779067 12 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779067 12:53981898-53981920 CGGGAAGGGAGAAAGGGGCCAGG 0: 1
1: 0
2: 5
3: 62
4: 692
1096779049_1096779060 -3 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779060 12:53981883-53981905 CAGGATCTGGGTACCCGGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 123
1096779049_1096779064 7 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779064 12:53981893-53981915 GTACCCGGGAAGGGAGAAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 205
1096779049_1096779072 29 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779072 12:53981915-53981937 GCCAGGGCATTGGCCCTGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 351
1096779049_1096779071 26 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779071 12:53981912-53981934 GGGGCCAGGGCATTGGCCCTGGG 0: 1
1: 0
2: 3
3: 38
4: 324
1096779049_1096779070 25 Left 1096779049 12:53981863-53981885 CCCCGTCCTTGTTGCCTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1096779070 12:53981911-53981933 AGGGGCCAGGGCATTGGCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096779049 Original CRISPR CTGGAAAGGCAACAAGGACG GGG (reversed) Intergenic
904168925 1:28577477-28577499 CTGGAAAGCAAGCAAGGATGGGG - Intronic
905008388 1:34729682-34729704 GTGGAATGGGAACAAGGAGGTGG - Intronic
905802196 1:40851645-40851667 TAGGAAAGGCAACAAGTCCGGGG - Intergenic
905931608 1:41791985-41792007 CTGGAAAGGCTTCACGGAGGAGG - Intronic
913286671 1:117233026-117233048 CAGGGAAGGCAACATGGAGGAGG - Intergenic
915518807 1:156429549-156429571 CTGGAAAGGCAGCAAAAAGGGGG + Intronic
917194278 1:172449589-172449611 ATGAAAGGGAAACAAGGACGCGG + Intronic
924030348 1:239879704-239879726 CTGGAGAGACAAGAAGGAAGAGG - Intronic
924291230 1:242538463-242538485 CTGGCAGGGCAACAAGGCGGTGG - Intergenic
1063423810 10:5935832-5935854 CTGGAAACACCACAAGGACAGGG - Intronic
1063969816 10:11373788-11373810 CTGGAGGAGCAGCAAGGACGGGG - Intergenic
1064308272 10:14188002-14188024 ATGGAGAGGCTACAAGGAGGTGG - Intronic
1064578343 10:16768594-16768616 TTGGAAAGGTGACAAGGATGTGG + Intronic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1066687270 10:37993036-37993058 CTGGAAAGGAAAGAATGATGGGG + Intergenic
1067011928 10:42722275-42722297 TTGGAAAGGTGACAAGGATGTGG - Intergenic
1067141839 10:43664552-43664574 ATGGAAAGGGAAGAAGGAGGTGG + Intergenic
1067311662 10:45119583-45119605 TTGGAAAGGTGACAAGGATGTGG + Intergenic
1067327361 10:45281992-45282014 CTGGAAAGACAGAAAGGACTGGG + Intergenic
1069702740 10:70438621-70438643 CCGGACAGGCCACAAGGACCTGG + Intronic
1070803062 10:79254807-79254829 TTTGAAAGCCAACAAGGCCGAGG - Intronic
1073972065 10:109055483-109055505 CAGGACAGGCAAGAAGGATGTGG + Intergenic
1074287821 10:112115176-112115198 CAGGAAAGGCTTCAAGGAGGAGG + Intergenic
1082067468 11:47912348-47912370 CTGGAAAGAGAAGAAGGATGTGG + Intergenic
1083687054 11:64382802-64382824 CTGGAAAGGTAACAGGGGCCAGG - Intergenic
1083959070 11:66003964-66003986 CTGGCAAGGGAAAAAGGACGGGG - Exonic
1084383786 11:68829522-68829544 CTGGAAAGGCAGAAAAGAGGAGG + Intronic
1084490757 11:69476895-69476917 CTGGAGAGCCAGCAAGGAAGAGG + Intergenic
1086859293 11:91906314-91906336 CTGGAAAGACAACGAGGAAATGG - Intergenic
1089480304 11:118799400-118799422 CAGGGAAGGCAACTAGGAGGAGG - Intergenic
1089812407 11:121142834-121142856 CAGGGAAGGCAACAAAGAGGTGG - Intronic
1090363511 11:126188817-126188839 GTGGAAAGACAAAAAGGAAGTGG - Intergenic
1090387239 11:126364300-126364322 CTGGAAAGGACACAGGGACCGGG + Intronic
1090389803 11:126381498-126381520 CTGGAAAGGACACAGGGACCGGG + Intronic
1090916613 11:131169939-131169961 CTGGAAAGGAGAGAAGGAAGAGG + Intergenic
1091028300 11:132161111-132161133 CTGGCCAGGCAAGAAGGAAGGGG - Intronic
1091962671 12:4711576-4711598 CTGGAAAGACATCAAGGACAGGG - Intronic
1092727894 12:11501897-11501919 GTGGAAAGGGAACAATGACATGG + Intergenic
1096589863 12:52650843-52650865 CTGGAAATTCAACCAGGATGCGG - Intronic
1096779049 12:53981863-53981885 CTGGAAAGGCAACAAGGACGGGG - Intergenic
1096912662 12:54999768-54999790 CAGAAAAGGCATCAATGACGAGG + Intergenic
1099050669 12:77778252-77778274 GAGGAAAGGAAGCAAGGACGGGG - Intergenic
1100186025 12:92141251-92141273 CTGGAAAGGCCACCAGAAAGTGG - Exonic
1102223089 12:111208021-111208043 CTGGGAAGGAAACAAGGAGAAGG + Intronic
1102682446 12:114699749-114699771 CTGGTAGGGCAACCAGCACGTGG - Intergenic
1103865253 12:124046410-124046432 CTGGGAAGGTAACTTGGACGGGG - Intronic
1104296410 12:127518802-127518824 CTGGGAAATCAACAAGGAAGAGG - Intergenic
1109272148 13:60267251-60267273 CTTGAGAGGCACCAAGGAAGGGG + Intergenic
1111656114 13:91155726-91155748 ATGGAAAAGCAACATGGCCGTGG - Intergenic
1112711749 13:102137609-102137631 CTGGAAAGTAAACAAGAACTAGG - Intronic
1113945105 13:114039584-114039606 CTGCAAAGGCCACAAGCAAGAGG - Intronic
1114810980 14:25899113-25899135 ATGGAAAGTCAGCAAGGACTAGG - Intergenic
1115780481 14:36763398-36763420 CTGGAAACCCCACAAGGACAGGG - Intronic
1116596097 14:46847531-46847553 CTGGAAAGGTAACTGGGAAGTGG + Intronic
1119562111 14:75598778-75598800 CTGGCAAGGCAACAAAGCCAAGG - Intronic
1119908463 14:78327199-78327221 GTGCAAAGGCAACAAAGACAAGG + Intronic
1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG + Intergenic
1124239484 15:28017896-28017918 CTGCAAAGGCAGCCAGGAAGCGG - Intronic
1124625555 15:31305637-31305659 CTGCAAATGAAACAAGAACGGGG - Intergenic
1125971825 15:43918005-43918027 GTACAAAGGCAACAAGGAAGTGG - Intronic
1126845158 15:52752828-52752850 CTTGAGAGGGAACAAGGAGGAGG + Intergenic
1128537482 15:68501813-68501835 CTGGAAGGGCTTCAAGGAAGAGG - Intergenic
1128810247 15:70566190-70566212 ATGGAAAGGGAGGAAGGACGGGG - Intergenic
1129470530 15:75751144-75751166 CTGGAAAGGAGTCAAGGAGGAGG + Intergenic
1129734470 15:77951994-77952016 CTGGAAAGGAGTCAAGGAGGAGG - Intergenic
1129841120 15:78743997-78744019 CTGGAAAGGAGTCAAGGAGGAGG + Intergenic
1130671590 15:85917700-85917722 CTGGAAATGCAACAAAAACTAGG - Intergenic
1131089209 15:89607843-89607865 CTGAAAAGTCAAGAAGTACGTGG - Intronic
1131410973 15:92208173-92208195 CTAGAAAAGCAACAAAGACAGGG - Intergenic
1131422079 15:92315301-92315323 CTGGAAAGGCAGGAGGGAGGAGG - Intergenic
1134414013 16:14028433-14028455 CTGGAAAAGCAACAGGCAGGTGG + Intergenic
1136640009 16:31556262-31556284 CTGGGAAGGGCACAAGGAGGTGG - Intergenic
1136664754 16:31800280-31800302 CTGGGAAGGGCACAAGGAGGTGG + Intergenic
1140519618 16:75569866-75569888 CTGGAAAGGCAAATGGGACTTGG - Intronic
1141632404 16:85295442-85295464 GTGGATGGGCAAAAAGGACGCGG - Intergenic
1143462761 17:7114582-7114604 CTGGGGAGGCAACTGGGACGAGG - Intronic
1143975066 17:10823524-10823546 CTGGGAAGGCCACAAGGCTGAGG + Exonic
1144199642 17:12928776-12928798 ATGAAAAGGCACCAAGGACTAGG - Intronic
1144807339 17:17976791-17976813 CTGGAAAGCCAGCAAGAAGGAGG + Intronic
1145931529 17:28689522-28689544 CTGCAAAGGCATCAAGGTCCAGG - Exonic
1146053688 17:29570713-29570735 CTGGAGAGGAACCAAGGATGTGG - Intronic
1146759771 17:35467083-35467105 CTGGCAAGGGACCAAGGACTGGG - Intronic
1147952689 17:44115805-44115827 CTGGAAAGCCAGGCAGGACGCGG + Intronic
1148690872 17:49526140-49526162 CTGGAAAGGCTTCCAGGAAGAGG - Intergenic
1149681326 17:58509327-58509349 CTGGGAAGGCTTCAAGGAAGAGG - Intronic
1149878870 17:60267455-60267477 CTGGAAAGGTAACATGGAAGTGG - Intronic
1150205206 17:63399509-63399531 CTGCAAAGGCCACAAGGAAGAGG - Intronic
1154012116 18:10583309-10583331 TTGGAAAGGCAACATTGATGGGG - Intergenic
1158132720 18:54170787-54170809 CTGGAAAGGCTTCTAGGAAGAGG + Intronic
1158391066 18:57045298-57045320 TTGGAAAGGCAACTAGGATTTGG + Intergenic
1158557665 18:58488708-58488730 AGGGAAAGGCTACAAGGACAAGG + Intronic
1161152357 19:2716478-2716500 CTGGAGAGGCACCATGGGCGTGG - Exonic
1162966077 19:14156725-14156747 CTGTAAAGGAAACAGGGCCGGGG + Intronic
1164943318 19:32268600-32268622 CTACAAAGGCAACAGGGACAGGG + Intergenic
925182931 2:1828530-1828552 CTGGACAGGCAACAGGGAGAAGG - Intronic
925716944 2:6792705-6792727 CTTGAAAGGCTACAGGGAGGAGG + Intergenic
925812523 2:7714337-7714359 CTGGAAAGACAACAGGCAAGAGG - Intergenic
926152230 2:10431810-10431832 CTGGCAAGGAAACATGGACCCGG - Intergenic
926633136 2:15155801-15155823 GTGGAAAGGGAACAAGGAAATGG - Intergenic
927478542 2:23432768-23432790 CTGGAAAGGCAACAGAGCAGAGG + Intronic
927625016 2:24706954-24706976 CTGGATTGGCAACAAGGCCCAGG + Exonic
930585554 2:53263407-53263429 CTGGGAAAGCAGCCAGGACGGGG - Intergenic
934651512 2:96093780-96093802 ATGGAAAGGCCACAGGGAGGAGG + Intergenic
938279326 2:130053158-130053180 CTGGCAAGGCCTCAAGGACCAGG + Intergenic
939255256 2:139735762-139735784 CTGAAAAGAGAAAAAGGACGAGG - Intergenic
940680843 2:156783076-156783098 CAGGAAAGGCAACAAGTAGTAGG + Intergenic
941293055 2:163700031-163700053 TTGGAAAGGAAAGAAGGAGGAGG + Intronic
942491113 2:176490541-176490563 CTGCAAAGGGAACGAGGACCCGG + Intergenic
942522598 2:176819794-176819816 CAAGACAGGCAACAAGGAGGGGG + Intergenic
946239555 2:218345288-218345310 CTGGGACGGCAGCAAGGACATGG + Exonic
946809704 2:223510746-223510768 CAGGAAAGGCCACACGGACAAGG + Intergenic
947508037 2:230724929-230724951 CTGGCAAGGGAAAAAGGACGGGG + Intronic
1169062630 20:2672680-2672702 CTCAAAAGGCAACATGGATGTGG + Intergenic
1169216561 20:3797599-3797621 CTGGGAAGGGAACAGGGACCCGG - Intronic
1170247278 20:14235886-14235908 CTGGAAAGGCAAATAATACGTGG + Intronic
1170629179 20:18053820-18053842 CTGGAAATGTAACCAGGACAGGG - Intronic
1172011036 20:31845658-31845680 CTGGAAAGGCAAAAAGGGGTGGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1174591139 20:51646034-51646056 CTGGAAAGGTAGAAAGGGCGGGG + Intronic
1175734770 20:61377436-61377458 CAGGAAAGGCACCAGGGAGGTGG - Intronic
1179207970 21:39301418-39301440 CTGGAAAGACCAAAAGGGCGAGG + Intronic
1180074793 21:45456908-45456930 CTGGCAAGGCAAAAAGGAAAGGG - Intronic
949669518 3:6382408-6382430 CTGGAATGGCATCAAGGAAGAGG + Intergenic
950496083 3:13335420-13335442 GTGGAAAGGCCACAGGGAAGGGG - Intronic
951816122 3:26757010-26757032 CTGGCAAGTCATCAAGGACAGGG + Intergenic
952211464 3:31232582-31232604 CTGGAGAGGCAACAGGGTTGTGG - Intergenic
954623743 3:52010809-52010831 CTGGAAAGGCAAGGAGGACATGG + Intergenic
954814725 3:53271475-53271497 CTGGGAAGGCGCCAAGGAGGGGG + Intergenic
955539556 3:59960042-59960064 CTGGAAAGGCAGAGAGGAGGTGG + Intronic
956382365 3:68678442-68678464 CTGGAAAGGGAACAGTGACAGGG + Intergenic
959990172 3:112622538-112622560 CTGGAAAAGCAACATAGACTTGG + Intronic
961798187 3:129424917-129424939 CTGGGAGGGCATCAAGGAAGAGG + Intronic
963357802 3:144232014-144232036 CTAGTAAAGCAACAAGGAAGAGG - Intergenic
967485945 3:190030645-190030667 ATGAAAAGGCAAAAAGGAAGAGG + Intronic
967513960 3:190345149-190345171 CTGGTAAGACAACAAGAACCAGG - Intronic
970154258 4:13125613-13125635 ATAGAAAGGCAAGAAGGAGGTGG - Intergenic
972316041 4:37926675-37926697 ATGGAAAGGCTACTTGGACGTGG + Intronic
974526332 4:63053900-63053922 CTGGAAAAGCAACAGAGACAGGG - Intergenic
976829924 4:89304103-89304125 CTGGAAAGGCTTCAAGGAGGAGG - Intronic
979833042 4:125324596-125324618 CAGGAAACTCAACAAGGAAGAGG + Intronic
981718486 4:147775575-147775597 GTGAAAAGGAAACAAGGACCAGG - Intronic
981843204 4:149136211-149136233 CTGGATAGGGAACAGGGAAGAGG - Intergenic
982485441 4:155959689-155959711 CTGGAGGGGCAACAATGACCCGG + Intergenic
984390819 4:179129753-179129775 CTGGAAAGGCCAAAAAGAAGAGG - Intergenic
984909959 4:184665354-184665376 ATAGAAAGGCAGCAAGCACGGGG - Intronic
985025368 4:185734634-185734656 CTGGAAAAGCAAGGAGGAGGTGG - Intronic
985805617 5:2040418-2040440 CTGGGAAGGCACTCAGGACGGGG + Intergenic
987185791 5:15417593-15417615 CTTGGAATGCAACTAGGACGGGG - Intergenic
989142474 5:38215247-38215269 CTGGAGAGGCAACAAGAACATGG - Intergenic
994536463 5:101036895-101036917 CTGGCAAGGCAACAAAGTCCAGG + Intergenic
996396164 5:123016322-123016344 CAGGAAAAGCAACAGGGAAGGGG + Intronic
999085091 5:148880964-148880986 CTGGAAAGGCAAGGAGAAAGAGG + Intergenic
999135191 5:149314025-149314047 CTGGAGGGGCAAGAAGGATGAGG + Intronic
1006427348 6:33974750-33974772 AGGGAAAGGCTACAAGGAAGGGG - Intergenic
1007404502 6:41626387-41626409 CTGGGAAGGCTTCAAGGACGTGG - Intergenic
1007757562 6:44110178-44110200 CTGGAAAAGCAGCAAAGCCGAGG + Intergenic
1010172216 6:72987299-72987321 AAAGAAAGGCAACATGGACGAGG + Intronic
1011021543 6:82819063-82819085 CAGCAAAGGCAAGAAGGACTTGG + Intergenic
1011391387 6:86857741-86857763 CTGGAAAGTTAAAAAGGACAAGG + Intergenic
1011797621 6:90974524-90974546 CTGGAGAGGCAACAATGAAGAGG - Intergenic
1015634665 6:135263666-135263688 CTGGAAACACAACAACGAAGAGG - Intergenic
1017896730 6:158686535-158686557 CAGGAAAGGTAACAAGGATCAGG + Intronic
1022426719 7:30276323-30276345 CTGCAAAGGCAAGAAGGCGGAGG - Intergenic
1023484890 7:40675701-40675723 CTGGAAAAGCATCAGGAACGGGG + Intronic
1024023032 7:45388064-45388086 CTGGCAATGAGACAAGGACGTGG + Intergenic
1026775826 7:73230434-73230456 CTGGACAGGGAACCAGGAGGAGG + Intergenic
1027016683 7:74783806-74783828 CTGGACAGGGAACCAGGAGGAGG + Intronic
1027071344 7:75162130-75162152 CTGGACAGGGAACCAGGAGGAGG - Intergenic
1027631981 7:80618298-80618320 CAGGAAAGGGAACAAGAAAGGGG - Intronic
1028530332 7:91831669-91831691 CAGGACAGGCAACAAGGGTGTGG + Intronic
1029795348 7:102888689-102888711 CTGGTAAGGCAAGAATGAGGTGG + Intronic
1033563777 7:142559083-142559105 CTTCAAAGCCAACAAGGACTGGG + Intergenic
1033710026 7:143933606-143933628 CTGTAAAGGCCAGAAGGAGGGGG - Intergenic
1041837429 8:62232294-62232316 ATGGAAAGGGAACAAGGAAAGGG - Intergenic
1042047088 8:64665344-64665366 TTGGAAAGGCTTCAAGGAGGAGG + Intronic
1045549596 8:103159424-103159446 CAGGAAAGCCAAAAAGGATGTGG - Intronic
1045689897 8:104749440-104749462 TAGGAAATGCAACAAGGAAGAGG + Intronic
1045824692 8:106383017-106383039 CTGGAAAGGTAGGAAGGAAGTGG + Intronic
1047226798 8:122961926-122961948 TTGGAAAGGCAAGAAGCAGGGGG - Intronic
1047568627 8:126073517-126073539 AAGGAAAGGCAATATGGACGAGG + Intergenic
1047609279 8:126505159-126505181 GTGGAATGGCAACAGGGAAGGGG + Intergenic
1048329223 8:133460944-133460966 CAGGAAATGCAACATGGACATGG + Intronic
1049545450 8:143228670-143228692 CTGGAAGGTCACCAAGGACTGGG - Intergenic
1049990734 9:989305-989327 CTGGAGAGGAAAAAAGGAAGTGG - Intronic
1050909792 9:11054607-11054629 CTGGAAAGACTAAAATGACGAGG + Intergenic
1051369203 9:16343964-16343986 CTGGAAAGAGAACAAGGTTGGGG - Intergenic
1052841419 9:33294545-33294567 CTGGAAAGGTGACAGGGAGGTGG - Exonic
1053056061 9:34993701-34993723 CTGGGAAGGAAAGAAGGGCGGGG - Intronic
1053200156 9:36146849-36146871 CTGGGAAGGCTGCAAGCACGAGG - Intronic
1055562489 9:77534876-77534898 TTTGAAAAGCAACAAGGAGGTGG + Intronic
1055965205 9:81859315-81859337 TTGGAAGGGCACCAAGGAAGTGG + Intergenic
1056040064 9:82656134-82656156 CTGGGAAGGGAAGAAGGAAGGGG + Intergenic
1058679668 9:107430125-107430147 CTGCAAAGGCAACAAGGAGTTGG + Intergenic
1058711678 9:107684362-107684384 CTGGAAAAACAACAAGGCCCAGG + Intergenic
1060046378 9:120344583-120344605 CTGGAAAGACAGCAAGGGCAGGG - Intergenic
1062102727 9:134737017-134737039 CTGGGAGGGCAGCAAGGACGAGG - Intronic
1062607410 9:137354378-137354400 CTGCAAAGGCAAACAGGAAGGGG + Intronic
1189838327 X:45042987-45043009 TTTGAAAGGCAAAAAGGTCGTGG + Intronic
1191861495 X:65669059-65669081 CTGGAAAGGCAAGAACGACTTGG - Intronic
1192131223 X:68553099-68553121 CTAGGAAGGCAAGAAGGAAGTGG - Intergenic
1194507880 X:94755173-94755195 GTAGAAAGGCAACCAGTACGTGG - Intergenic
1197101881 X:122665666-122665688 CTGGAATGGCAACAAAGAAGTGG - Intergenic
1197412704 X:126138854-126138876 CTGGATGGGCAACCAGGATGCGG + Intergenic
1199002329 X:142653837-142653859 CTCCAAAGGCAACATGGACAGGG - Intergenic
1199309627 X:146307751-146307773 CTGGAAAGGCAGCTAGGAGTGGG + Intergenic
1199374744 X:147094674-147094696 CAGTAAAGTCTACAAGGACGAGG + Intergenic