ID: 1096780018

View in Genome Browser
Species Human (GRCh38)
Location 12:53986222-53986244
Sequence TGCCCCGGCCATGGGTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096780018 Original CRISPR TGCCCCGGCCATGGGTGCTA AGG Intronic
900648666 1:3720484-3720506 TGTCCCTGCCATGGGTGTGAGGG - Intronic
903560008 1:24220179-24220201 TGCCCAGGCCATGGGGGCAGTGG - Intergenic
905559793 1:38917467-38917489 TGCCTAGGCAATGAGTGCTATGG - Intronic
906453198 1:45970333-45970355 TGCCCTGGCACTGGTTGCTATGG + Intronic
907275969 1:53316817-53316839 TCCCCAGGCCATGTGTGCTCTGG - Intronic
907393448 1:54173873-54173895 TGCCCTGGTGATGGTTGCTATGG - Intronic
911101799 1:94101377-94101399 TGCCCAGGCCCTGGGTGGTGCGG - Intronic
912635232 1:111285792-111285814 TGCCTCGGCAATGGGAGCAATGG - Intergenic
915087840 1:153400127-153400149 TGCCCTGGCCATGGGTAGTGGGG - Intergenic
915213888 1:154327890-154327912 TGCCCCTGCCTTGGGTGACATGG - Intronic
915693004 1:157709319-157709341 TGCAGCTGCCATGTGTGCTAAGG + Intergenic
916870982 1:168914315-168914337 TGCCCCAGCAGTGGGTGCTGAGG - Intergenic
921960694 1:221030774-221030796 TGCCTTGGCCAGGGGTGCAATGG - Intergenic
922364845 1:224854174-224854196 TGCCCCACCCATGGGGGCTGAGG + Intergenic
1066599861 10:37093210-37093232 TGCCCCAGCCATGGCTGAAAGGG + Intergenic
1069784483 10:70979020-70979042 TGCCCCAGCCAGTGGTGCTCAGG - Intergenic
1072790871 10:98316970-98316992 TCCCTCTGCCCTGGGTGCTAGGG + Intergenic
1074143416 10:110696670-110696692 TGCCTGGGCCATGGCTGATAGGG + Intronic
1076775671 10:132696810-132696832 TGGCCCGGCCCTGGGTGCTGTGG - Intronic
1076775680 10:132696835-132696857 TGGCCCAGCCCTGGGTGCTGTGG - Intronic
1076911419 10:133392087-133392109 TGCCCAGCCCATGGGAGCCAGGG + Intronic
1077037894 11:504108-504130 GGCCCAGGCCTTGGGTGCTGCGG - Intronic
1083295924 11:61715617-61715639 TGCCCCCACCATGAGTGCTCCGG - Intronic
1085732892 11:79014258-79014280 TGCCTGGGCCATGGTTCCTAAGG - Intronic
1085782168 11:79419410-79419432 TCCCCGTGCCGTGGGTGCTAAGG - Intronic
1087462430 11:98462537-98462559 TGCCCTGGCCGTTGGTGCTCTGG - Intergenic
1088833771 11:113560071-113560093 GGCCCAGGCCAGGGGAGCTAAGG - Intergenic
1091209547 11:133844529-133844551 TGTCCTGGCCATGGGTGGGAGGG + Exonic
1096780018 12:53986222-53986244 TGCCCCGGCCATGGGTGCTAAGG + Intronic
1103993000 12:124811799-124811821 GGGCCCGGCCATGGCTGCTCGGG - Intronic
1106048159 13:26165144-26165166 TGCCCCAGCCATGGCTGAAAGGG + Intronic
1106311961 13:28562648-28562670 AACCTAGGCCATGGGTGCTAGGG + Intergenic
1111893272 13:94109216-94109238 TGCCCAGTGGATGGGTGCTATGG + Intronic
1117181936 14:53200365-53200387 TGCCCCAGCCATGGCTGGAAGGG + Intergenic
1119545910 14:75471285-75471307 TGCTCCGGCCCTGGGTGGCAGGG - Intronic
1122468717 14:101951421-101951443 GGCCCAGGTCATGGGTGCTGGGG - Intergenic
1127217213 15:56835961-56835983 TGCCCTGGCCTTGTGTCCTAGGG - Intronic
1132240273 15:100252514-100252536 CGCCCCGGACATGGGTACTGTGG + Intronic
1132573814 16:655804-655826 CTCCCCGGCCATGTGTGCTGTGG + Exonic
1138132229 16:54490390-54490412 TGCCCTGGTCATGAGTGTTATGG - Intergenic
1141574084 16:84952971-84952993 TCCCCAGGCCATGGCTGATAAGG - Intergenic
1141750835 16:85956921-85956943 TGCCCAGCCCCTGGGTGCCAGGG + Intergenic
1141827636 16:86492332-86492354 TGCCTTAGCCATGGGTGCCAGGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143474135 17:7193303-7193325 TGGCCTGGGCATGGGTACTATGG + Intronic
1147671608 17:42180069-42180091 TGCCCCGGTGATGGGCGCTATGG + Intronic
1147948404 17:44093244-44093266 TGCCCCTGCCATGGGGGGTCTGG - Intronic
1148611950 17:48970502-48970524 TGCCGCCGCCATGGGTACTTGGG + Intergenic
1151299474 17:73212356-73212378 TGCCGAGGCCATTGGAGCTATGG + Intronic
1152847836 17:82613516-82613538 TGCCCCGGACGTGGGTGCGAAGG - Intronic
1154502355 18:15003150-15003172 TGCCCCGGCCCAGGCTGCCATGG - Intergenic
1156746152 18:40393797-40393819 TGCCCCAGGCATGGGTGCACGGG - Intergenic
1157500782 18:48189133-48189155 TGCCCTGGGCAGGGGAGCTATGG - Intronic
1159472925 18:68880135-68880157 TGCCCCGCCCAAGGCAGCTAAGG + Intronic
1160735123 19:658851-658873 TGCCAGTGCCAGGGGTGCTACGG + Intronic
1161233366 19:3186461-3186483 TGGCCCGGCCATGGGTTCCGGGG - Intronic
1161628370 19:5339645-5339667 TGCCCGCGCCGTGGGTGCGAGGG - Intronic
1161780141 19:6286378-6286400 TGCCCAGGCTATAGGTGCCAAGG - Intergenic
1162495677 19:11022110-11022132 TGCCCCAGCCTTGGGTTCCAGGG - Intronic
1167048786 19:47066742-47066764 TGCCCAGCCCAAGGGTGCTGAGG - Exonic
1168313300 19:55472517-55472539 TGCCCAGGACATGGGAGCCAGGG - Intergenic
1168405596 19:56108629-56108651 TGGCGCTGCCCTGGGTGCTAGGG - Intronic
928924755 2:36566057-36566079 TGTCCCTGGCATGGGTGTTAAGG - Intronic
933779537 2:85791973-85791995 TGCCTCTGCCATGGCTGATAGGG + Intergenic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
935631827 2:105218395-105218417 TGCCCTGGCCCTGCCTGCTAGGG - Intergenic
938291891 2:130154964-130154986 GGCCCCGGCAAAGGGTGCTGTGG - Intronic
938464659 2:131518000-131518022 GGCCCCGGCAAAGGGTGCTGTGG + Intergenic
948461565 2:238132317-238132339 TGCCCCAGCCCAGGGTGCTCCGG + Exonic
948903139 2:240966126-240966148 TGCCCCAGCCATGGGAGGTTGGG - Intronic
949044769 2:241867341-241867363 TGCCCCAGGCCTGGGTCCTAGGG + Intergenic
1171118732 20:22549689-22549711 TGCCCCAGCCATGGCTGAAAGGG - Intergenic
1171339592 20:24416879-24416901 TCCCACGTCCATGGGTGCTCCGG - Intergenic
1172529023 20:35617864-35617886 AGCCCCTGCCCTGGGTGCTTTGG + Intronic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1175392142 20:58634267-58634289 TGCCACGGCCCTTGCTGCTACGG + Intergenic
1175877525 20:62237432-62237454 TGACCCGGCCGTGGTTGCTCCGG + Intronic
1175895048 20:62332464-62332486 TGCCCCGGCACAGGGTGCTGTGG + Exonic
1176679216 21:9810245-9810267 TGCCACGGCCACGGGTGTAAGGG + Intergenic
1176897078 21:14392764-14392786 AGCCCCAGACATGAGTGCTAAGG - Intergenic
1178552951 21:33557190-33557212 TGCAGCTGCCATGTGTGCTAAGG + Exonic
1179791450 21:43758113-43758135 TGCCCCTGCAGTGGGTGTTACGG + Exonic
1181539848 22:23567195-23567217 TGCCCGGCCCATGAGTGCTGAGG - Intergenic
950184962 3:10939292-10939314 AGCCCCTGCCATGGGGGCTGAGG - Exonic
950704754 3:14772905-14772927 GGCCCCGGCCCGGGGTGCTGGGG + Exonic
951358965 3:21702335-21702357 TGCTCCAGCCATGGCTGATAGGG - Intronic
957653164 3:83035412-83035434 TGCCCAGGCTGTTGGTGCTATGG + Intergenic
960937470 3:122912670-122912692 TGCCCCGGCCGTAGATGCAATGG - Intronic
963483328 3:145904198-145904220 CGCCCAGGCTATGGGTGCCATGG - Intergenic
964426300 3:156557478-156557500 TGCCACGGCTATGTGTGCCACGG - Intergenic
966840121 3:184081444-184081466 TGCCCAGGCCGTAGGTGCCAAGG - Intergenic
969633836 4:8353733-8353755 TGCCCCAGCCATGGGTCCCCTGG - Intergenic
971191404 4:24432286-24432308 TGTGCCTGCCATGGGTGATAAGG + Intergenic
974037212 4:56827586-56827608 TGCTCCAGCCATGGGTGAAAAGG + Intergenic
979987038 4:127327906-127327928 TGCCCTGGACATAGGTGTTAGGG - Intergenic
986664683 5:10090572-10090594 TTCCTCTGCCATGAGTGCTATGG - Intergenic
995312713 5:110731633-110731655 TGCTCCGGCCATGGCTGAAAGGG - Intronic
998963077 5:147509405-147509427 TGCCCGGGCCATGGCGGCCAGGG + Intronic
1004351380 6:14893179-14893201 TGCCCTGGCCCTGGGGGCTGAGG + Intergenic
1011284206 6:85706348-85706370 TGCCCAGGCCATTCGTGCCAAGG + Intergenic
1019610490 7:1934279-1934301 TGCCCGGGCCATGGCTGATTGGG - Intronic
1020013793 7:4819840-4819862 TGGCCCGGCGATGGGAGCCAGGG - Intronic
1023545202 7:41311277-41311299 TGCCCAGGCCAAGGGTGCCACGG - Intergenic
1023722729 7:43112916-43112938 TGCCCAGGCCAGGGCTGCCAAGG + Exonic
1026624291 7:71978592-71978614 TGCCCCTGCCCTCAGTGCTAAGG - Intronic
1032264324 7:130360288-130360310 GGCCCCAGCCATGGGTGCTGGGG + Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1038648998 8:29385440-29385462 GGCCCCCGCGATGGATGCTATGG - Intergenic
1038732330 8:30138707-30138729 TGCCCTGGCCGTGGCTGCCATGG - Exonic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1045231292 8:100309751-100309773 TGTCCCGGGCAGGGGCGCTAGGG + Intronic
1048658992 8:136575072-136575094 TGCCCCAGCTCTGGGTGCTCTGG + Intergenic
1049258113 8:141624675-141624697 TGCCCCTGCCAGGGGAGCCAAGG - Intergenic
1051367532 9:16331804-16331826 TGCCCCGGCCTGGGGTGCCCAGG + Intergenic
1057188506 9:93072537-93072559 TGCCCCAGCCATGTGTGCCACGG - Intronic
1058082261 9:100712623-100712645 TGCCCCAGCCATGGCTGAAATGG - Intergenic
1059755970 9:117293687-117293709 TGCCAAGGCCTTGGGTGCTAAGG - Intronic
1060920906 9:127419649-127419671 TGCCCCAGCCATAGTTGCTAAGG - Intergenic
1061033440 9:128100520-128100542 TTCCCCGGCCTCGGGTGCTGTGG + Intronic
1062547551 9:137070449-137070471 GGCCCCGGCCATGGGCGCCCGGG + Exonic
1203664388 Un_KI270754v1:12781-12803 TGCCACGGCCACGGGTGTAAGGG + Intergenic
1193700912 X:84760118-84760140 TGCCTGGGCCAGGGGTACTATGG - Intergenic
1196973890 X:121138066-121138088 TGCTCCAGCCATGGCTGCAAGGG - Intergenic
1198046413 X:132907633-132907655 TGCCCCATGCATGGCTGCTATGG + Intronic
1199614747 X:149647706-149647728 AGCCCAGGCCATAGGTGCCAAGG - Intergenic