ID: 1096780291

View in Genome Browser
Species Human (GRCh38)
Location 12:53987749-53987771
Sequence CTCTCTTGCCTCTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096780291 Original CRISPR CTCTCTTGCCTCTGGCCTGG TGG (reversed) Intronic
900512376 1:3066797-3066819 CTCCTTTGCCCCTGGCCTGGAGG - Intergenic
901066981 1:6498837-6498859 CTGTCCTGCCTCTAGGCTGGAGG + Intronic
903259947 1:22126221-22126243 CTCCCCTGCTCCTGGCCTGGAGG - Intronic
904712373 1:32440050-32440072 CTCTCTTCCCCCTAACCTGGTGG + Intergenic
905183555 1:36180513-36180535 CTCTCTGGCCTCTTCCCTTGGGG + Exonic
905239076 1:36570936-36570958 CTCCCCTGACTGTGGCCTGGAGG + Intergenic
905285070 1:36873928-36873950 CTCTCTGACATCTGTCCTGGTGG - Intronic
905648196 1:39639427-39639449 CTCACCTGCCTCTGCCCAGGCGG + Intronic
905887897 1:41501624-41501646 GACTCTGGCCTCTGCCCTGGTGG + Intergenic
906253078 1:44326318-44326340 CCCTCTTCCCTGTGGCCAGGAGG - Intronic
906523433 1:46480193-46480215 GTCTTTGGCCTTTGGCCTGGGGG - Intergenic
907351566 1:53836535-53836557 CACTGTTGCATCTAGCCTGGGGG - Intronic
909722801 1:78796132-78796154 CACTGTTGCCACTGGCCTTGAGG + Intergenic
912384083 1:109262717-109262739 CGTTCGTGTCTCTGGCCTGGCGG + Intronic
912700987 1:111878132-111878154 CTGTCTTGCCTCTGGGTTAGTGG + Intronic
913112961 1:115672403-115672425 CACTCGTGCCTCGGGCCTGCTGG - Intronic
914205542 1:145524107-145524129 CTCTCTTGCCTGTGAACTTGTGG + Intergenic
914347729 1:146814393-146814415 CGCTCCTGCCTGTGGCCTGGCGG + Intergenic
914414927 1:147470979-147471001 CTGCCTTCCCTCTGACCTGGAGG + Intergenic
915593036 1:156881403-156881425 CTCTCTTGCCCCCAGCCTAGTGG + Intronic
915633537 1:157170919-157170941 CGCCCTGGACTCTGGCCTGGTGG + Intergenic
915671253 1:157490748-157490770 CGCCCTGGACTCTGGCCTGGTGG - Intergenic
915908386 1:159896534-159896556 CGCTATTGCCTCTGGCCCAGAGG - Intronic
915918848 1:159959291-159959313 CTCTCTTACCCCTGACCAGGAGG + Intergenic
915942486 1:160127610-160127632 TACTCTCGCCTCAGGCCTGGAGG + Exonic
916213793 1:162379187-162379209 CTCTCTTGCTTCAGGACTAGAGG - Intronic
917745187 1:177999926-177999948 CTGTCTTGCCTCAGACCTGAGGG - Intergenic
918330398 1:183454683-183454705 CTCACCTGCCTCTGGGCTAGAGG - Intergenic
919685212 1:200478125-200478147 TTCTGTTGCCTCTGGCCTCAAGG + Intergenic
920363435 1:205435287-205435309 GTCTCTTGCCACTGCCATGGAGG + Intronic
920924369 1:210328250-210328272 GTCTCTTGGCTCAGGCTTGGAGG + Intronic
922107013 1:222521318-222521340 CCCTCTTGCCTCTAGCCTCACGG + Intergenic
922155629 1:223038155-223038177 TTCTCTGTCCTCTGTCCTGGAGG - Intergenic
922273892 1:224058757-224058779 CACTCTTGCTTCTAGACTGGAGG - Intergenic
922317679 1:224456984-224457006 CGCTCAGGCCTCTGCCCTGGAGG + Intronic
922405312 1:225306484-225306506 CTCTCTTGACGCTTGCCTGTAGG - Intronic
922592079 1:226784910-226784932 CTGTCTTGCTGCTGGCCTTGGGG + Intergenic
922807958 1:228400366-228400388 CGCCCTGGCCTGTGGCCTGGCGG - Intronic
922817069 1:228457424-228457446 CTCACTTGCCCTTGGCCTTGTGG + Exonic
924351033 1:243114807-243114829 CTCTGCTTCCTCTGGCCTTGGGG + Intergenic
1063188125 10:3668585-3668607 CCCCCTTGCATCTGCCCTGGGGG + Intergenic
1066212122 10:33250862-33250884 CTCTCCTCCCTCTAGCCAGGTGG + Intronic
1066490260 10:35887573-35887595 CTCTGTTGCCTCAAGCCTTGGGG + Intergenic
1069867484 10:71512671-71512693 CTCTCCTGCCCTTGGGCTGGGGG + Intronic
1070325637 10:75387137-75387159 TTGTCTTCCCTCTGGCCTTGAGG + Intergenic
1070759749 10:79016675-79016697 CTCTCCTGCCTCTGGACTTCTGG - Intergenic
1071106513 10:82103741-82103763 CTCTCTGGCCTCAGAACTGGAGG - Intronic
1071451099 10:85791981-85792003 CTCCCTGGCCTCCTGCCTGGGGG - Intronic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1077852424 11:6085774-6085796 CTGTGTTGCCTGTGGCCTGCAGG - Intergenic
1078456414 11:11479056-11479078 CTCTCTAGCCCTAGGCCTGGTGG + Intronic
1080613689 11:33927339-33927361 GTCTCTTGCTTCTGTCGTGGAGG - Intergenic
1081402792 11:42662202-42662224 CTCTCCTGCCTCTGGCCCATGGG + Intergenic
1081808245 11:45901450-45901472 CTCCCTAGCAGCTGGCCTGGGGG - Intronic
1082988957 11:59191066-59191088 ATCTCTTACCTCTGCCTTGGTGG + Intronic
1083091544 11:60204544-60204566 CTCTCTTTCCTCTTTCCTGTTGG + Intronic
1083949916 11:65948142-65948164 TTCTCTTCCCTCTTACCTGGTGG - Exonic
1083959716 11:66007784-66007806 CTCTCTTGCCCCTGGCCTGATGG - Intergenic
1084267468 11:68012393-68012415 GGCTGTTTCCTCTGGCCTGGGGG - Intronic
1084983752 11:72849174-72849196 TTCTCTTGCCCCTGTTCTGGTGG - Intronic
1085481312 11:76825089-76825111 CTCTCTTGCCAGGGGCCTGAGGG + Intergenic
1085935825 11:81140678-81140700 CTCTTTAACCTCTGGCATGGAGG - Intergenic
1086113078 11:83219509-83219531 TTCTCTTGGCCCTGGCCTAGAGG - Intronic
1087348933 11:97006481-97006503 TTCTCTTTCCTCTAGCCTTGCGG - Intergenic
1089313814 11:117577153-117577175 CTCTCTGGTCTCTGGCCCAGGGG + Intronic
1090404294 11:126467781-126467803 CCCTCTGGCCTCTGGCCTCAAGG - Intronic
1091556510 12:1577571-1577593 CTCTGTTTCCTCCAGCCTGGGGG - Intronic
1091970296 12:4780911-4780933 CTCTGAGGCCTCTGGCCAGGAGG - Intronic
1092095132 12:5835829-5835851 CTCAGGTGTCTCTGGCCTGGAGG + Intronic
1094703912 12:32896757-32896779 CTCGCCTGCCTCTGGACTCGCGG + Intronic
1096627879 12:52906429-52906451 CTCTATTTCCTCTGGCCCGTTGG - Intronic
1096780291 12:53987749-53987771 CTCTCTTGCCTCTGGCCTGGTGG - Intronic
1096816234 12:54203625-54203647 CTATCCTGCCTCTGGCCCTGGGG - Intergenic
1097287799 12:57891016-57891038 CTCACCTGCCTCAGGCTTGGTGG - Intergenic
1097430503 12:59499455-59499477 CTCTCTTCCCCCTAGCCTGCTGG - Intergenic
1098712219 12:73777014-73777036 CTCTGTAGCCTCTTACCTGGAGG + Intergenic
1098972142 12:76867996-76868018 TTCTCTTGCCTCTCTTCTGGTGG + Intronic
1101504560 12:105333977-105333999 CTCTCTTGGCTTTTGTCTGGTGG + Intronic
1102024660 12:109707421-109707443 CTCTCTGTCCTCTGGCCAGCTGG - Intergenic
1102680035 12:114684931-114684953 CTCCCCTGCGTCTGGGCTGGGGG + Intergenic
1103205216 12:119123622-119123644 CTCTCTTGCCTCTTGTCTTTTGG - Intronic
1103413206 12:120727026-120727048 CTCTCTGTCCTAGGGCCTGGCGG + Exonic
1103690243 12:122766755-122766777 CTCTCCTGCCTGTGGCCTAGTGG + Intronic
1103848719 12:123917463-123917485 TCCTCGTGCCTCTGGCCTGCTGG + Intronic
1104719123 12:131034867-131034889 CGCTCTTGCCTGGGGCCTGCAGG + Intronic
1106212326 13:27661438-27661460 CTGTCTTAGCTCTGACCTGGGGG - Intronic
1107155724 13:37165140-37165162 CTCTCTTCCCTGCAGCCTGGTGG + Intergenic
1109272115 13:60267045-60267067 TTCTCTTGGCCCTGGCCTAGAGG - Intergenic
1109801257 13:67381284-67381306 CTCACTTACCTGTGACCTGGAGG + Intergenic
1112100304 13:96181540-96181562 CTCTCAGGGCCCTGGCCTGGTGG + Intronic
1112163746 13:96895839-96895861 CTCTCTTCCTTGTAGCCTGGTGG + Intergenic
1112315855 13:98361520-98361542 CTCTCTTGCCACTGCCAGGGTGG - Intronic
1112444397 13:99450983-99451005 CTCTCTTCCCTCCTCCCTGGAGG + Intergenic
1112561304 13:100517176-100517198 CACTCCTGCCTCAAGCCTGGAGG + Intronic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113826008 13:113254196-113254218 CTCTCGTGGGTCTGACCTGGAGG + Intronic
1114878368 14:26752017-26752039 CTCTCTTCCCCGTAGCCTGGTGG + Intergenic
1121221253 14:92287248-92287270 CTCTCTTGCTGCTGCCCTGTCGG + Intergenic
1122115673 14:99526153-99526175 CCCTCCTGCTTCTGGCCTGTGGG + Intronic
1122757993 14:103997698-103997720 CTTTCTTCCCACTGCCCTGGAGG - Intronic
1123409236 15:20044681-20044703 ACCTCTTCCCTGTGGCCTGGGGG - Intergenic
1123518567 15:21051389-21051411 ACCTCTTCCCTGTGGCCTGGGGG - Intergenic
1124590587 15:31049928-31049950 CTGTCTTGCCTGTGTCCTGGTGG + Intronic
1125085441 15:35724308-35724330 CCCACTTGACTGTGGCCTGGAGG - Intergenic
1125753945 15:42049625-42049647 CTATCTGGCCCCTGGCTTGGAGG - Intronic
1126100970 15:45117969-45117991 CTCTCCTGGCCCAGGCCTGGCGG - Exonic
1126702494 15:51380736-51380758 CTCACTTGCCTCTCCCCAGGTGG + Intronic
1126896981 15:53268538-53268560 TTCTCTGGCCTTTGGCCTGCAGG - Intergenic
1127784198 15:62341921-62341943 CTCTCCTGTCTCTACCCTGGAGG - Intergenic
1129227703 15:74179605-74179627 CTCCCGGGCCTCTGGCCTGCAGG - Intronic
1129364066 15:75043691-75043713 CTGTCTAGCTTCTGGCCTGCAGG + Intronic
1129466064 15:75725050-75725072 TTCCCCTGCCTCTGACCTGGTGG + Intronic
1129604869 15:77019929-77019951 TTCTCTTCCAGCTGGCCTGGAGG - Intronic
1129664006 15:77569319-77569341 CTATCTTGCCTCCGGCCCCGTGG + Intergenic
1131698710 15:94909674-94909696 CTCTGTTGCCTCAGGCATTGGGG + Intergenic
1132139821 15:99383182-99383204 GTCTCTGGCCTTTGGCTTGGGGG + Intronic
1132585137 16:702887-702909 CTCTCTTGGCTCAGGCCAGATGG - Intronic
1132993153 16:2807762-2807784 CTCTGTCTCCTGTGGCCTGGGGG - Intergenic
1135789252 16:25378325-25378347 GTGTCTTGGCTCTGGCCTTGGGG + Intergenic
1136003112 16:27311328-27311350 CTCGCTTGCCTCTAGACTGCCGG - Intergenic
1136106213 16:28031846-28031868 CTCTCAGGCCCCTGGCATGGAGG - Intronic
1138421850 16:56904125-56904147 CTCTCTTCCCTCTACCCTGCTGG + Intronic
1138491520 16:57379882-57379904 TTCTCTTGCCCCTGGCCTGCAGG + Intronic
1139593564 16:67946074-67946096 GTCCCTTGCCTCAGGTCTGGAGG - Exonic
1139986309 16:70901145-70901167 CGCTCCTGCCTGTGGCCTGGCGG - Exonic
1140147413 16:72324703-72324725 CTCTCTTGTGCCTGGCTTGGCGG + Intergenic
1140703379 16:77603287-77603309 CTGTCCTTCCTCTAGCCTGGTGG + Intergenic
1141871703 16:86790910-86790932 AGTTCTTGCCTCTGGCCAGGAGG + Intergenic
1144201639 17:12947410-12947432 CCCTCTGGCCTCTGACCTAGGGG + Intronic
1144310443 17:14009124-14009146 TTCTCTTGCTCCTGGCATGGTGG - Intergenic
1144364170 17:14526053-14526075 CTCTCCTCCCGCTAGCCTGGTGG - Intergenic
1144389492 17:14780264-14780286 CTCTATTGTCCCTGGCCTGATGG + Intergenic
1146660769 17:34663815-34663837 CTCTCTTCTTTCAGGCCTGGTGG + Intergenic
1146668148 17:34718410-34718432 CTGTCTAGCCCCTGGCCTGTGGG - Intergenic
1146692036 17:34883375-34883397 CTCACCTGCCCCTTGCCTGGGGG + Intergenic
1147579044 17:41618270-41618292 CTCTCTCTCCTCGTGCCTGGAGG - Intergenic
1147596756 17:41722880-41722902 CTCTTCTGCCAGTGGCCTGGGGG - Exonic
1147720807 17:42538177-42538199 GTCTCTTTCCTCTGGGCTGTGGG + Intronic
1148341499 17:46876146-46876168 TTCTCCTGCCTCTGCCCTGCTGG + Intronic
1150259077 17:63773848-63773870 CACTCTTGCCTCTGGCCACGTGG - Exonic
1150463636 17:65373142-65373164 CTTTCTAGCTTTTGGCCTGGAGG + Intergenic
1151258815 17:72900670-72900692 CACTATTTCCTCTGCCCTGGAGG - Intronic
1151466572 17:74289572-74289594 CTCTCTTCCCTCTCCCCTGCAGG + Exonic
1151691429 17:75688431-75688453 CATTCTTGCCTGTGGCCTCGGGG + Intronic
1152094276 17:78263906-78263928 CACTCTTGCCCATGCCCTGGTGG - Intergenic
1152472344 17:80496958-80496980 TTCTCTTCCCTCTGGCATGGTGG + Intergenic
1152586890 17:81193217-81193239 CTCCCCTGCCTCCGGCCTGAGGG + Intronic
1153595913 18:6725118-6725140 CTCCCTTGCCTCTGGCTTCAGGG - Intergenic
1153819267 18:8819212-8819234 CTCTCGGGCCTGTGGGCTGGTGG - Exonic
1155205589 18:23555289-23555311 CACTCTCCCCTCTGGCCTGCTGG - Intronic
1157492385 18:48133231-48133253 CTAGCTGGCCTCTGGCATGGAGG + Intronic
1157518300 18:48327056-48327078 GTCACCAGCCTCTGGCCTGGAGG + Intronic
1157583746 18:48788134-48788156 CTCTCTAGCCTTTAGGCTGGGGG + Intronic
1157907102 18:51579006-51579028 CTCCCTTCCCTCTGCCCTGTTGG + Intergenic
1160720992 19:596834-596856 CTCTCCTGCCTCTCGCCCTGGGG - Intronic
1160738746 19:676446-676468 CACTCTGGCCTCTGCCCTGGGGG + Exonic
1161509027 19:4660483-4660505 CCCCCGTGCCCCTGGCCTGGGGG + Intronic
1162063505 19:8111023-8111045 CACTCTGTCCTCTGCCCTGGCGG + Intronic
1162986222 19:14271909-14271931 CTCTCTAGCATCTCCCCTGGGGG + Intergenic
1163582339 19:18146106-18146128 CCCTCTGGCCTGAGGCCTGGAGG + Intronic
1163612350 19:18308069-18308091 ATCTCTGGCCTCAGGCCTGCTGG - Intronic
1163721276 19:18899333-18899355 CTGTGCTGCCTCTGGCCTGCAGG + Intergenic
1163849875 19:19656766-19656788 CCCTCCTGCCTCTGCCCTGCAGG - Exonic
1165424519 19:35738607-35738629 CCATCTTGCCCCTAGCCTGGGGG + Exonic
1166062898 19:40337849-40337871 ACCCCTTTCCTCTGGCCTGGCGG - Intronic
1166092492 19:40519382-40519404 CTCTCTTTCCCCTGGGCAGGTGG + Exonic
1166538707 19:43592147-43592169 CTCTCCTTCCTGTGGCCTGCGGG - Exonic
1167648101 19:50716631-50716653 CTCTCCTGCCGCTGGCCAGTGGG + Intronic
925341165 2:3137519-3137541 CTCTCTTCCCTCTGTCCTGTGGG - Intergenic
926157728 2:10466870-10466892 CCCTCTGGCCCTTGGCCTGGAGG - Intergenic
926418011 2:12669804-12669826 CTGTCTTTCCTATTGCCTGGGGG - Intergenic
926654339 2:15384089-15384111 GTAAATTGCCTCTGGCCTGGAGG - Intronic
927239954 2:20912639-20912661 CTCTCTTCCCTCTGGCCACTTGG + Intergenic
927247866 2:20972278-20972300 CTCTCTTGCCTCATCCCTAGTGG - Intergenic
927842650 2:26455321-26455343 CTCCCTTGCCTCTGACGGGGAGG - Intronic
929127856 2:38537268-38537290 CTCTCTTTCCCCCGGGCTGGAGG + Intergenic
930290836 2:49491029-49491051 CTCTCTGGTCACTGTCCTGGGGG + Intergenic
930427303 2:51228381-51228403 CTCTGTTTGCACTGGCCTGGTGG + Intergenic
930466392 2:51755581-51755603 CTCTCTTCCTTCTGCTCTGGTGG + Intergenic
930737217 2:54791684-54791706 TTCTCTTGGCTCTAGCCTGCAGG - Intronic
931628972 2:64282658-64282680 CTCTCCTTCCACAGGCCTGGGGG - Intergenic
933155291 2:78966269-78966291 CTTTCTTGCTTCTGGCCAGCAGG - Intergenic
933405956 2:81859776-81859798 CTCACTTGCCTCTTAGCTGGAGG - Intergenic
934052325 2:88221154-88221176 CTCTATTTCCTCTTTCCTGGGGG + Intergenic
935512740 2:103995857-103995879 TTCTCCTGCCTCAGGCATGGTGG - Intergenic
935605585 2:104969608-104969630 CTCTCCTGCCTCGGACCTGCTGG + Intergenic
935675413 2:105590890-105590912 CTCTCTGGCCTCTGCCATTGAGG + Intergenic
936283940 2:111166348-111166370 CACATTTCCCTCTGGCCTGGCGG + Exonic
936669662 2:114642577-114642599 CTGACATGCCTATGGCCTGGGGG - Intronic
937075779 2:119105352-119105374 CTCTCCTTCCTCAGGTCTGGAGG - Intergenic
937934632 2:127232928-127232950 CTGTCTTGCACCTGGCCTTGGGG - Intergenic
938203495 2:129397403-129397425 CTCTGTCTCCTCTGGCCTGTAGG - Intergenic
940333372 2:152499960-152499982 CTCTTTTTCCTCTAGCCTGGAGG + Intronic
940547297 2:155103488-155103510 CTCTCTTGCCACTGCCATGTAGG - Intergenic
941088638 2:161147541-161147563 CTCCCTTGGCTGTGGGCTGGGGG + Intronic
942277549 2:174334179-174334201 CGCTCTGGCCTCTGACCCGGGGG - Intergenic
942406689 2:175663430-175663452 CTATCATGCCCCTGCCCTGGAGG + Intergenic
944785119 2:203062453-203062475 CTCTGTTGCCTGTGACCTGCAGG - Intronic
947280322 2:228445363-228445385 CTCTCTTGCCTCTGCTTTGCTGG + Intergenic
948429500 2:237910025-237910047 CTCCCTTCCTTCTAGCCTGGTGG + Intronic
1168965964 20:1898090-1898112 ATTTCTTCTCTCTGGCCTGGAGG + Intronic
1169551040 20:6701443-6701465 CTCTCTTTCTTTTGTCCTGGGGG + Intergenic
1170368301 20:15620444-15620466 CTCTCTTGCCCCTTGCCTCCTGG + Intronic
1170789897 20:19499033-19499055 CTGTCTGGCCTCTGGGCTAGGGG - Intronic
1172160275 20:32863162-32863184 CCCTCTGGACTCTTGCCTGGTGG + Intronic
1173354044 20:42270318-42270340 CTCTGGTGCACCTGGCCTGGAGG + Intronic
1174054054 20:47785826-47785848 CGCTTTTACCTCCGGCCTGGGGG + Exonic
1174898824 20:54476812-54476834 CTCTCTTGGCTCTTCGCTGGAGG + Intronic
1174961868 20:55166862-55166884 CTCTTTTCCACCTGGCCTGGTGG + Intergenic
1175336596 20:58200157-58200179 GCCTCGTGCCTCTGGGCTGGCGG - Intergenic
1175715701 20:61253054-61253076 CTCTCCTGCCCAAGGCCTGGGGG + Intronic
1175908573 20:62393862-62393884 CCCTCTGGCCTCTGTGCTGGTGG - Intronic
1177645943 21:23899780-23899802 CTCTCTTATCACAGGCCTGGAGG - Intergenic
1178365563 21:31986440-31986462 CTCTCTTGCTTCCGGGATGGTGG + Intronic
1179242984 21:39608548-39608570 CTCTGTGGCCTCAGGGCTGGAGG + Intronic
1179466761 21:41581048-41581070 CTGTCTCTCCTCTGACCTGGTGG - Intergenic
1179530183 21:42012963-42012985 GTCTCTTGCCTCTGGGCTTCTGG + Intergenic
1180559854 22:16607364-16607386 CTCTCTGCACTCTTGCCTGGTGG + Intergenic
1181075143 22:20370791-20370813 CTTTCTTGCATGTGGCCTTGTGG - Intronic
1182226088 22:28800170-28800192 CTCCGTCGCCTTTGGCCTGGCGG - Intronic
1183866746 22:40710316-40710338 AACCCCTGCCTCTGGCCTGGAGG - Intergenic
1184129927 22:42511711-42511733 CTGCCTTGGCTCTGACCTGGCGG - Exonic
1184357901 22:43994742-43994764 CTGGCTTGCCCCTGGTCTGGTGG + Intronic
1184445122 22:44542600-44542622 CTCTTTGGCATCTGGCCAGGAGG + Intergenic
1185335639 22:50269911-50269933 CTCCCAGGCCTCAGGCCTGGTGG + Intronic
949360646 3:3228821-3228843 CTCTCCTCCCCCTGGCCTGGTGG - Intergenic
949458950 3:4269682-4269704 CTGTCTTGCCTTTGGACTGTTGG - Intronic
952966694 3:38625472-38625494 CTCTCCTGCCTCCAGACTGGAGG + Intronic
953098930 3:39807446-39807468 CTCTTGTCCCTTTGGCCTGGAGG - Intergenic
953129904 3:40127879-40127901 CCCTCATCCCTCTGGCCTTGAGG + Intronic
955891719 3:63657290-63657312 CTCTCTTGCCTCTGGAATGGGGG - Intronic
957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG + Intergenic
958081109 3:88747231-88747253 CTCTCTTGTGCCTGGCTTGGTGG + Intergenic
960424030 3:117484026-117484048 CTTTCTGGCTTCTGGCCTAGAGG + Intergenic
960692132 3:120357831-120357853 CTCACTTGCTTCTCACCTGGTGG + Intergenic
960709801 3:120516629-120516651 TTCTATTGCCTCTGACCTTGGGG + Intergenic
961046976 3:123715690-123715712 CACTGTTGCCTTTGTCCTGGTGG + Intronic
961768296 3:129229178-129229200 CTCTCTTGCCTCTAGGGTAGAGG - Intergenic
962646460 3:137445337-137445359 CTCTCCTGTCACAGGCCTGGAGG - Intergenic
963071913 3:141311625-141311647 CTCTCTGGCTTCTGGTCGGGTGG - Intergenic
963412904 3:144954315-144954337 CTCTCCTTCCCCTAGCCTGGTGG + Intergenic
963606087 3:147412721-147412743 CTCTCTTGGCTCTCGGCTTGGGG + Intronic
967778046 3:193404984-193405006 CTCTCATGCCTCTCAGCTGGAGG + Intronic
968651986 4:1763807-1763829 GTCTCTGGCCTCTGGCCGCGGGG + Intergenic
968747454 4:2367712-2367734 CTTTGTTGGCTCAGGCCTGGGGG + Intronic
968764625 4:2461883-2461905 CTCTTCTGTCTCTTGCCTGGAGG - Intronic
969586567 4:8097462-8097484 AGCTCTGGCCCCTGGCCTGGTGG + Intronic
969688444 4:8689948-8689970 CTCTCCTGCCCCGGGCCTGCTGG + Intergenic
971367602 4:25989958-25989980 CTCTCATGGCTCTGGCTTGTGGG - Intergenic
972026410 4:34383904-34383926 CTCTTCTCCCTCTAGCCTGGTGG - Intergenic
972462782 4:39320901-39320923 CTCTCTTGCTTATTGCCTGTAGG - Intronic
976140562 4:81987118-81987140 CTTTCTTGCTTCTGTCCTGCAGG - Intronic
976594340 4:86880467-86880489 CTCACTCCCTTCTGGCCTGGAGG - Intronic
976625160 4:87172366-87172388 ATCTCTTGATTCTGGCCTTGTGG + Intronic
978162398 4:105564733-105564755 CTATCTCATCTCTGGCCTGGAGG + Intronic
984581138 4:181511408-181511430 CTCTCCTTGCTCAGGCCTGGAGG + Intergenic
986530085 5:8726890-8726912 CTCTCTAGCCACAGGCCCGGAGG - Intergenic
986568766 5:9143885-9143907 CTTTCTTGGCTTTGTCCTGGAGG - Intronic
986916613 5:12627006-12627028 CTCTCTTGGTTCTGGCCCAGGGG + Intergenic
989977106 5:50600288-50600310 CTCTTTTGCGGCAGGCCTGGTGG + Intergenic
990158557 5:52908156-52908178 CTCTCTTGCTTCTGCCCCTGTGG - Intronic
990619918 5:57548742-57548764 CTCTCTTTCTTCTGGCTTGTAGG + Intergenic
992038805 5:72808482-72808504 CCCTCCTGCCTCTTGACTGGGGG - Intergenic
993984652 5:94583351-94583373 CCCTCTTGTGTCTGGCTTGGTGG + Intronic
995811748 5:116114756-116114778 CTCTCATGTCTCAGTCCTGGTGG + Intronic
997528392 5:134567825-134567847 ACCTCTTCCTTCTGGCCTGGTGG - Intronic
997658962 5:135575705-135575727 CTGTCATGCCTGTGGCCTAGAGG - Intronic
999122059 5:149217320-149217342 CTCTCCTGGCTCTGCCTTGGGGG + Intronic
999239606 5:150119934-150119956 CACTCATGCCTCTGGCCTGGTGG - Intronic
999385424 5:151150781-151150803 CTCGGTTTCCTCTGACCTGGGGG + Intronic
999494482 5:152083628-152083650 TTCTCCTGCCTCTATCCTGGAGG + Intergenic
999776284 5:154815152-154815174 CTCTCTTGCCTCCAGGATGGAGG - Exonic
1001044678 5:168362807-168362829 CTGTCTTCCCTCTGCCCTGCTGG - Intronic
1001566293 5:172701570-172701592 CTTTCTTGCCTCTGTCCTGCTGG + Intergenic
1003093703 6:3125670-3125692 CTCTTCTGCCTCTGACCTGGAGG - Intronic
1004048639 6:12050744-12050766 CTTTCTAGCCCTTGGCCTGGTGG + Intronic
1006015417 6:31077028-31077050 CTGGCTTGCCTCTGCCCAGGTGG - Intergenic
1006084883 6:31588595-31588617 CTCTCTTGTCTCTGCCCCTGAGG - Exonic
1006945307 6:37780491-37780513 CCATTTGGCCTCTGGCCTGGGGG - Intergenic
1007096208 6:39214763-39214785 CTCCCCTGACCCTGGCCTGGGGG - Intronic
1007622641 6:43224261-43224283 CTCTTCTGCCTCTGGCCCTGAGG - Exonic
1007635618 6:43298143-43298165 CTGTCTTGCCTGGTGCCTGGGGG - Intronic
1007655960 6:43451083-43451105 TTCTCCTGCCTCTGTCCTGAGGG - Exonic
1009879985 6:69554846-69554868 CTCTCTGGCCTTTGGCCTCTGGG + Intergenic
1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG + Intergenic
1014345733 6:120267560-120267582 CTCTTTTAGCTCAGGCCTGGTGG + Intergenic
1014571679 6:123016506-123016528 CTCCCTTGCCTCTGCCCTACTGG + Intronic
1016132191 6:140488206-140488228 CTTTCTTGCCTTTGGGTTGGGGG - Intergenic
1018298239 6:162372305-162372327 TACTTCTGCCTCTGGCCTGGAGG - Intronic
1018546537 6:164942815-164942837 ATCTCTGGCCTCTGCCATGGGGG - Intergenic
1018812490 6:167307992-167308014 CTCTCTTGGCTCTGGCCCATTGG - Intronic
1019727707 7:2612170-2612192 CTTTCCTGCCTCAGGCTTGGAGG + Exonic
1022101687 7:27173052-27173074 CGCTCTTTCCTGTGGCCGGGAGG - Intronic
1022595346 7:31708254-31708276 CTCTCCTGTCTATTGCCTGGTGG - Exonic
1023509400 7:40934738-40934760 CTCTCTTGTGCCTGGCTTGGCGG - Intergenic
1026126453 7:67583803-67583825 CTCTCCTCCCCCTAGCCTGGTGG + Intergenic
1026638073 7:72101696-72101718 CGCTCTTGCAACTGGCCTGCAGG + Intronic
1026950728 7:74344839-74344861 CTCTCTGGTCTCTGGCCTTCAGG - Intronic
1027609651 7:80344558-80344580 CTTGCTTGCCTCTGGCTTGTGGG - Intergenic
1031583509 7:123505697-123505719 CCCTCTTGTCACAGGCCTGGAGG - Intronic
1031683935 7:124709268-124709290 CTCTCATTCCTCAGTCCTGGGGG + Intergenic
1032120373 7:129150805-129150827 CTCTCTTTCCTCCTCCCTGGAGG - Intronic
1032467910 7:132158142-132158164 CTCTCTTGGCTCTTGGCTGAAGG - Intronic
1034617391 7:152430505-152430527 CTCTCTGCACTCTTGCCTGGTGG - Intronic
1034750742 7:153566708-153566730 CTCTTTGGCCTCTGGCCTCCTGG - Intergenic
1034893290 7:154859004-154859026 CGCTCTTGACTGTGGGCTGGGGG + Intronic
1035171864 7:157021554-157021576 CCCTCTTCCCTCGGGCCAGGCGG - Intergenic
1035663314 8:1363289-1363311 CTCTCCTGCCTCTGCCTTGCAGG + Intergenic
1036643360 8:10597659-10597681 CTCTCAGGTCTCCGGCCTGGGGG + Intergenic
1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG + Exonic
1036917149 8:12815066-12815088 CTCACTTGCGTCAGGCGTGGTGG + Intergenic
1036918995 8:12833615-12833637 CTCTGTTGCCTGTTGCCAGGAGG + Intergenic
1037812261 8:22094157-22094179 CTGTCCTGTCTCTGTCCTGGAGG - Intronic
1038815815 8:30902958-30902980 CTCTCTTGCCTTTTCCCTGAGGG - Intergenic
1040112343 8:43572079-43572101 CCCCCTTGATTCTGGCCTGGGGG + Intergenic
1040554513 8:48467441-48467463 TTCCCATGGCTCTGGCCTGGTGG + Intergenic
1040843458 8:51809294-51809316 CTCTCTTTCTCCTGGCCGGGTGG - Exonic
1042575717 8:70216692-70216714 CTTTCTTGTCTCTGCCCTGGAGG + Exonic
1044912472 8:97074925-97074947 CTCTTTTTCATCTGGCCTAGAGG - Intronic
1045929497 8:107605463-107605485 TTCTCTTGGCCCTGGCCTAGAGG - Intergenic
1048476588 8:134747859-134747881 ATCTCTGGTCTCTGGGCTGGTGG + Intergenic
1049423045 8:142525265-142525287 CTCTCCTGCCTCCCGCCTGGAGG - Intronic
1050299336 9:4241228-4241250 ATCTTTTGCCTCAGGCTTGGAGG - Intronic
1050944493 9:11500303-11500325 CTCTCTTCTCCCTAGCCTGGTGG - Intergenic
1053182268 9:35982912-35982934 CTCTCTTCCCTCTCTCCTAGAGG + Intergenic
1055763712 9:79638196-79638218 CTGACTAGCCACTGGCCTGGTGG - Intronic
1055963674 9:81844518-81844540 CTCTCTGCCCTCTGGCCCAGAGG + Intergenic
1056919378 9:90772580-90772602 CTCACACCCCTCTGGCCTGGGGG - Intergenic
1057101918 9:92369369-92369391 CTCTCTTGTATCTGGCCCTGGGG + Intronic
1060456327 9:123802252-123802274 CTCTCCGCCCACTGGCCTGGAGG + Intronic
1061222868 9:129262363-129262385 CTCCCTTTCCTCTTGCTTGGGGG - Intergenic
1061536797 9:131255304-131255326 TTCTGTCGCCTCTGGCTTGGTGG - Intergenic
1062214978 9:135384265-135384287 CTCTCTTGCCTGTGGCTTCCTGG - Intergenic
1062413254 9:136435088-136435110 CTCTCATGCCTCTTCCCGGGAGG - Intronic
1062476292 9:136728975-136728997 CGCTCTAGCCTTAGGCCTGGAGG + Intergenic
1062645587 9:137546559-137546581 CTCTACTCCCCCTGGCCTGGAGG - Intronic
1187369710 X:18694808-18694830 CTTCCTTGAATCTGGCCTGGAGG + Intronic
1188872275 X:35387683-35387705 CTCTCCTCCCCCTGGCCTCGTGG - Intergenic
1189543182 X:42013668-42013690 CTCTCTTGCCTCATGCCCTGTGG + Intergenic
1191868285 X:65723638-65723660 TTCTCTTTCCTCTGGAATGGAGG + Intronic
1193555915 X:82953235-82953257 GGCTCCTGCCTCTGCCCTGGTGG - Intergenic
1195482912 X:105368504-105368526 TTCTATTCCCTCTGGCCTGCAGG + Intronic
1195670483 X:107465678-107465700 ATATCTTCCCTATGGCCTGGTGG + Intergenic
1196899082 X:120365640-120365662 CTCTCTGGCCTGTGGCTGGGAGG + Intronic
1199080120 X:143567714-143567736 ACCTCTTGCCTCTGGCTTCGAGG - Intergenic
1200297907 X:154940980-154941002 CTCTCTTAGGTCAGGCCTGGTGG - Intronic
1200839072 Y:7761887-7761909 CTCTCCTGTGTCTGGCTTGGTGG + Intergenic