ID: 1096780561

View in Genome Browser
Species Human (GRCh38)
Location 12:53989492-53989514
Sequence CACCAGGCACAAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096780561_1096780570 29 Left 1096780561 12:53989492-53989514 CCCTCCTCCCTTTGTGCCTGGTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1096780570 12:53989544-53989566 ATGCAATGCGACTGCAAAAAAGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096780561 Original CRISPR CACCAGGCACAAAGGGAGGA GGG (reversed) Exonic
900185547 1:1331531-1331553 CACCAGGTACAGAGGTGGGACGG + Exonic
900206650 1:1434578-1434600 CACCTGCCTGAAAGGGAGGAAGG + Intergenic
900423034 1:2563902-2563924 CCCCAGGCATGACGGGAGGAGGG - Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901768892 1:11520699-11520721 CACCAGGGACAAGATGAGGATGG - Exonic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
904130500 1:28272231-28272253 AGCCAGGCACAAAAGGAGGAGGG + Intronic
904566789 1:31433119-31433141 CACCAGGCAGAAGTGGAAGAAGG - Exonic
904566961 1:31434031-31434053 CACCAGGCTCATGGGGAAGATGG + Intronic
905036810 1:34924010-34924032 CAACAGGCAGGAAGGGATGATGG - Intronic
905109576 1:35585448-35585470 CTCCAGGCTTCAAGGGAGGAGGG - Intronic
905197923 1:36295616-36295638 AAACAGGGAGAAAGGGAGGAAGG - Intronic
905293320 1:36938262-36938284 GACCAGGCAGAGAGAGAGGATGG + Intronic
905405218 1:37727915-37727937 AACCAGGCACATAGGTTGGATGG - Intronic
905954364 1:41979749-41979771 CACCATGCAGCAAGGAAGGAGGG - Intronic
906534341 1:46543497-46543519 CCCAAGGCCCAAAGTGAGGAGGG - Intergenic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907364328 1:53946440-53946462 CCCCGGGCACAAAGCTAGGAAGG - Exonic
908009762 1:59764208-59764230 CATCAGTCAGAAAAGGAGGAAGG + Intronic
908733913 1:67256231-67256253 CTTCAGGAACAAAGGGAGTAGGG + Intronic
908839391 1:68263264-68263286 CACCAAGCAGAAAGGGGGAAGGG - Intergenic
909300816 1:74011014-74011036 CACCAGGCTCAAATGGAAGTAGG + Intergenic
910843212 1:91581210-91581232 CACCAGGGACTAGTGGAGGAGGG + Intergenic
910857007 1:91705977-91705999 CACCAGGCTCAAAAGAAGAATGG + Intronic
911241981 1:95477303-95477325 CAGCAGGCAAAAAGAGAGAATGG - Intergenic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
911685565 1:100773046-100773068 CACCAGGGGCTAAGGGAAGAAGG - Intergenic
912025915 1:105171883-105171905 TATCAGGAAGAAAGGGAGGAAGG + Intergenic
912659787 1:111517063-111517085 CACTTGGGACAGAGGGAGGAAGG - Intronic
913959619 1:143328288-143328310 AACTAGGCACAAAAGGAGCAAGG - Intergenic
914053978 1:144153861-144153883 AACTAGGCACAAAAGGAGCAAGG - Intergenic
914125168 1:144812504-144812526 AACTAGGCACAAAAGGAGCAAGG + Intergenic
914225853 1:145719019-145719041 CTCCAGGCTGAAAGGGAAGAAGG - Intergenic
914830485 1:151167266-151167288 CACCAGGCTGGAAGGGCGGAGGG + Intronic
914906421 1:151749701-151749723 CATCATGCACACAGAGAGGAGGG + Intergenic
915164345 1:153940324-153940346 CTTCAGGCACAAAGTGAGGGAGG - Intronic
915866859 1:159510253-159510275 CACAAGGAACGAAGGAAGGAAGG - Intergenic
915893438 1:159792301-159792323 CTCCAGGGACAAAGGAAGGCTGG + Intergenic
915974306 1:160375029-160375051 GACCAGGCACTGGGGGAGGAGGG + Intergenic
916432408 1:164743759-164743781 TTCCAGGCAAAAAGGAAGGAAGG + Intronic
916794171 1:168150303-168150325 CACTAGGAAGAAAGGAAGGAAGG + Intergenic
916917576 1:169426490-169426512 TACCAGACACTCAGGGAGGAAGG - Intronic
917214071 1:172659584-172659606 CACCAGGCATAAGGGGATGGAGG + Intronic
917791900 1:178504370-178504392 CAACAGGGACAAAGGGAGGAAGG + Intergenic
918161234 1:181902049-181902071 CAGCTGGCACACTGGGAGGATGG + Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
919933603 1:202237087-202237109 GACCAGACACAGAGGCAGGAGGG - Intronic
920205305 1:204286923-204286945 AACCAGGCACAATAGGGGGAAGG - Intronic
920457580 1:206112930-206112952 AACCAGGCAAAACGGAAGGAAGG - Intronic
921781667 1:219172829-219172851 TACCAGGGACTAAGGGAAGAGGG - Intergenic
922248758 1:223827003-223827025 CACTAGGTACAAAGTGAGGAAGG + Intronic
922438130 1:225626490-225626512 TAGAAGGCACAAAGGCAGGAGGG - Intronic
923152130 1:231242622-231242644 GAGCAGGCACGAAGGGAAGAGGG + Intronic
923352754 1:233125614-233125636 AACCAGGTACAATGGCAGGAGGG - Intronic
923797330 1:237170450-237170472 CACCTGGCAGAGACGGAGGAGGG - Intronic
1062984225 10:1752488-1752510 CACCATCCACACAGGAAGGATGG + Intergenic
1063112828 10:3051806-3051828 CACAACGCACAAATGGAGCAAGG + Intergenic
1063367407 10:5499601-5499623 CAATCGGAACAAAGGGAGGAGGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064101861 10:12471038-12471060 AAAAAGACACAAAGGGAGGAAGG - Intronic
1064146952 10:12833290-12833312 CACCAGGCACACGGGGTGGGGGG + Exonic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1066748354 10:38626141-38626163 CACCATTCAGAAAGGGAGGAGGG - Intergenic
1066968324 10:42291634-42291656 CACCACTCAGAAAGGGAGGAGGG + Intergenic
1067089599 10:43259860-43259882 AACCACTCACAAAGGCAGGAAGG + Intronic
1067356434 10:45532550-45532572 CACATGGCATAGAGGGAGGAAGG - Intronic
1067978035 10:51048321-51048343 CACAAGGAAGAAAGGGAGGGAGG - Intronic
1068600869 10:58955051-58955073 CACCAGTAACAAAGGGAGAAGGG + Intergenic
1069423486 10:68268826-68268848 CACCAAGCACAACTGAAGGAGGG + Intergenic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1070319325 10:75343054-75343076 AACCAGGCAAAATGGGGGGAAGG + Intergenic
1070331047 10:75417577-75417599 CACCTGGCTCAGAGTGAGGAGGG - Intergenic
1071443654 10:85726540-85726562 CACAAGGGATGAAGGGAGGAGGG + Intronic
1071963864 10:90832781-90832803 TCCCAGGCCCACAGGGAGGAGGG + Intronic
1072263212 10:93702381-93702403 AACTTGGCACACAGGGAGGAAGG - Exonic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1072577373 10:96712647-96712669 AACCAGCCACATAGGAAGGAAGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1072850632 10:98887648-98887670 TAAAAGGCAAAAAGGGAGGAGGG + Intronic
1072936064 10:99714716-99714738 CACCTGTCACAAAGGAAAGAAGG + Exonic
1073105676 10:101031042-101031064 GACCAGGCACAAAGGGGTGGGGG - Intronic
1073225558 10:101915584-101915606 GACGTGGCAGAAAGGGAGGAAGG + Intronic
1076054191 10:127357882-127357904 CACCTGGCACCATGGCAGGAAGG - Intronic
1076120687 10:127934721-127934743 CCCCAGGCACAGAGCGGGGAAGG - Intronic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076771979 10:132670705-132670727 GACCCGGCACAAAGGGAGACTGG - Intronic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1077094663 11:794231-794253 CACCAGGCACTAAGTGGGGGTGG + Intronic
1077326566 11:1966606-1966628 CAGCAGGCACCGGGGGAGGAGGG - Intronic
1077459813 11:2703361-2703383 AACCAGACACAAAAGGAGAATGG - Intronic
1077726650 11:4681892-4681914 CAACACGCACAATGGGATGAAGG + Exonic
1077802189 11:5551006-5551028 CACAAGGAATAAAAGGAGGAAGG - Intronic
1079954933 11:26850638-26850660 CAAAAGGCACAAACAGAGGATGG - Intergenic
1079966299 11:26984149-26984171 CACCAGCAACAAAGGGATCAAGG - Intergenic
1080820917 11:35805586-35805608 CAACAGGAAGAAAGGGAGGGAGG - Intronic
1081587642 11:44398324-44398346 CCCCCGGCACAGAGGGAAGAGGG - Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081667160 11:44923327-44923349 CACCCAGCAGAGAGGGAGGATGG + Intronic
1081806688 11:45894740-45894762 CTCCAGGAGCAAGGGGAGGAAGG + Intronic
1083160549 11:60851561-60851583 CACCAGGCCGACAGGGAGGCTGG + Exonic
1083470398 11:62880524-62880546 AACCAGGGGCAAATGGAGGATGG + Intronic
1083535546 11:63463802-63463824 CAAATGGCACAGAGGGAGGAAGG - Intronic
1083801176 11:65047403-65047425 GAACAGCCACAAAGAGAGGAGGG + Intronic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084517922 11:69646481-69646503 ACCCAGGCACAAAGGGAGAGGGG - Intronic
1084552284 11:69851940-69851962 CTCCAGGCAGAAAGGAAGGCGGG - Intergenic
1084927279 11:72523591-72523613 GACCAGACACATAGGGAGGATGG + Intergenic
1084953937 11:72681409-72681431 TGCTAGTCACAAAGGGAGGAGGG + Intergenic
1085775827 11:79365706-79365728 CAACAGGCACAGAGGGAAGCAGG + Intronic
1085928216 11:81047808-81047830 GACCAAACACAATGGGAGGATGG + Intergenic
1087784750 11:102342045-102342067 CACCATGCAGAAGGGGAAGAAGG + Intergenic
1089025047 11:115260463-115260485 CACCAGGCACAAAGATAGAGAGG - Intronic
1089219051 11:116855515-116855537 CACAAGTCACACAGGAAGGAAGG + Intronic
1089297155 11:117476601-117476623 CACCAAGCACAGAGCAAGGATGG - Intronic
1090168517 11:124577512-124577534 CAGCAGGCACACAGAGAGAATGG + Intergenic
1090620124 11:128553200-128553222 CTCCAGGCTGATAGGGAGGAGGG + Intronic
1090790438 11:130088945-130088967 CACCAGACAAAAATAGAGGATGG - Intronic
1091330537 11:134728183-134728205 CCCCAGCCACCACGGGAGGAGGG - Intergenic
1202809547 11_KI270721v1_random:21785-21807 CAGCAGGCACCGGGGGAGGAGGG - Intergenic
1091419955 12:328224-328246 TATCAGGCAGAGAGGGAGGAGGG + Intronic
1091658607 12:2363962-2363984 CACCAGGCACGAGGGGATGATGG - Intronic
1092603147 12:10089158-10089180 CACCAAGCACAAAGTCAGCAGGG + Exonic
1094125387 12:27017581-27017603 GCTCAGGCACAAAGGGAGGTGGG - Intergenic
1094541119 12:31364001-31364023 CACCAGGCAGGGAGGCAGGAGGG + Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096760768 12:53840231-53840253 CACCAGGCCCAAAGGAAGCAAGG - Intergenic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1096963726 12:55607158-55607180 AAGCAGGCAAAAAGGGAGAATGG + Intergenic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1099347651 12:81523127-81523149 CTCCTGACAGAAAGGGAGGATGG + Intronic
1100291423 12:93218294-93218316 CACTAGTCACAAGGGAAGGAGGG + Intergenic
1101236769 12:102797587-102797609 CACCATGCATGAAGGGAGGATGG + Intergenic
1101521785 12:105490475-105490497 CACCTGGGACCAAGGGAGGAAGG - Intergenic
1101694371 12:107110597-107110619 CCCCAGGTACAAGGGGAAGATGG - Intergenic
1102176732 12:110881275-110881297 GAGCAGGCCAAAAGGGAGGAAGG + Exonic
1103555888 12:121766236-121766258 CACCAGACACAAACCGAGGGTGG - Intronic
1103684797 12:122723474-122723496 CACCAGGGACACAGTGGGGAAGG - Intergenic
1103924226 12:124414771-124414793 CCCCAGGCACCACGGGAAGATGG - Intronic
1104191367 12:126484966-126484988 CACCACGTACAAAGAGAGGGAGG + Intergenic
1104610635 12:130225001-130225023 CTCCACGCAGAAAGGGAGAAGGG + Intergenic
1105729161 13:23194303-23194325 CAAGAGGCATAAAGGCAGGATGG - Intronic
1107871113 13:44747409-44747431 CACCAGGAACAAACAGAGGACGG + Intergenic
1108868188 13:54947773-54947795 AACAAGGAACAAAGGAAGGAAGG - Intergenic
1109878928 13:68445338-68445360 AACCTGGCACAAAGTGAGGCAGG + Intergenic
1110619394 13:77578319-77578341 CACCACCAAGAAAGGGAGGAGGG + Intronic
1110985739 13:81965709-81965731 CAACAGGAAAAAAGGCAGGAAGG - Intergenic
1111998638 13:95189882-95189904 AATCCAGCACAAAGGGAGGAAGG + Intronic
1113448556 13:110389049-110389071 CATCAGACACAAAGGAAGGATGG - Intronic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113870043 13:113553765-113553787 CAAAAGGCAGACAGGGAGGAAGG - Intronic
1113879234 13:113614450-113614472 CCCAGGGCACAAACGGAGGAAGG - Intronic
1113881947 13:113631959-113631981 CACCAGACACAAAGCGGGGTGGG - Intronic
1113905031 13:113815225-113815247 CAACGGCCACAAAGAGAGGAAGG + Exonic
1114232008 14:20791575-20791597 TACCAAGGACAAAGTGAGGAGGG + Intergenic
1114495809 14:23131405-23131427 GACTAGGCACAAAGAGAGGGAGG + Intronic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1117197613 14:53356026-53356048 CAGCAGGCACCATGGAAGGACGG - Intergenic
1117455653 14:55894440-55894462 CACCAGCCACGAAGTGAGGATGG + Intergenic
1117949611 14:61068993-61069015 CTTCAGGCACAAAGAGATGAAGG - Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118405787 14:65422371-65422393 CACCAGGATTAAAGGCAGGAAGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119328198 14:73774755-73774777 CAGCAAGCACTAAGGGAGGCTGG + Intronic
1121448555 14:93993660-93993682 CACCAGGCACAGCAGAAGGAAGG - Intergenic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1121726264 14:96153156-96153178 CAAAAGACACAAAGGTAGGAAGG + Intergenic
1121865808 14:97361446-97361468 CACAAGGCACAAAGGCGGCATGG + Intergenic
1122005509 14:98700232-98700254 AACAAGGCCCTAAGGGAGGATGG + Intergenic
1122162681 14:99796800-99796822 TCTCAGGCACAAAGGAAGGATGG - Intronic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1124106176 15:26740150-26740172 CACCTGGCACACTGTGAGGATGG - Intronic
1127469341 15:59276401-59276423 CACACTGTACAAAGGGAGGAGGG + Intronic
1128297169 15:66532507-66532529 AACCAGGTACAAAGCCAGGAAGG - Intronic
1129136737 15:73559822-73559844 CATAAGGCACAAACGTAGGAAGG - Exonic
1129241008 15:74252264-74252286 CCCCAGCCAGACAGGGAGGAAGG - Intronic
1129606686 15:77028455-77028477 CGCCAGGGAAAAAGGGAGGCTGG + Intronic
1130082777 15:80748867-80748889 CACCAGGCTGCAAGGGAGGCTGG + Intronic
1130091534 15:80825057-80825079 CACCAGCTAAAGAGGGAGGAAGG + Intronic
1131404115 15:92149750-92149772 CACTAGGAACAAAGTGAGCAAGG - Intronic
1131899539 15:97072548-97072570 CACCAGGAACGAAGGAAGAAAGG - Intergenic
1132627180 16:897032-897054 CACCAGACCCAAAGGGAGCCGGG + Intronic
1133513285 16:6481932-6481954 TACCAGGAACAAAACGAGGAGGG - Intronic
1133787218 16:8982900-8982922 CAGCAGGAAGAAAGGAAGGAAGG + Intergenic
1133922189 16:10163286-10163308 CACCAGGCTCAGAAGGTGGAAGG + Intronic
1134205578 16:12235198-12235220 CACCAGGGACAGAGAGAGAAAGG - Intronic
1134281303 16:12819504-12819526 CAACTGGCGGAAAGGGAGGAGGG + Intergenic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1136655484 16:31706721-31706743 CACCTGGCACCCAGGAAGGAAGG - Intergenic
1136734406 16:32451160-32451182 CACCACTCAGAAGGGGAGGAGGG + Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1139664786 16:68448053-68448075 CGCCAGGCACAGCGGGAGGGAGG + Intronic
1141145877 16:81529662-81529684 TACCAGGGACAGAGGGAGGTGGG + Intronic
1141770338 16:86085929-86085951 CACCCAGCTCTAAGGGAGGATGG - Intergenic
1142150235 16:88509445-88509467 CATTAGGCACACAGGGAGGCTGG + Intronic
1142214107 16:88822409-88822431 CAGCAGGCACCCTGGGAGGAGGG + Intronic
1203018674 16_KI270728v1_random:378442-378464 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1203037009 16_KI270728v1_random:651600-651622 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1143330960 17:6135382-6135404 CAGCAAGGACTAAGGGAGGAAGG + Intergenic
1143653454 17:8278822-8278844 CAACAGGCACCAAGGGAAGGAGG - Intergenic
1145207448 17:20992102-20992124 CCCCAGGCCCAAAGGAAGAAAGG + Intergenic
1146501360 17:33367570-33367592 CAGCAGGCATGAAGGGAGGCAGG - Intronic
1146953610 17:36923103-36923125 CCCCAGGCCCAAGGGGAGGTAGG + Intergenic
1148392009 17:47279495-47279517 CAGCAACCACAAAGGGAGGGAGG + Intronic
1148703200 17:49604480-49604502 CCTCAGGCACAAAGGGAGGTAGG + Intronic
1149001240 17:51759819-51759841 CTTAAGGCACGAAGGGAGGATGG - Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1152717606 17:81907429-81907451 TGCCAGGGACAGAGGGAGGAGGG + Intronic
1154961694 18:21315943-21315965 CCCCAGGCCCACAGGGGGGAGGG - Intronic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1155335783 18:24764128-24764150 TACCAGGCCCACATGGAGGAGGG - Intergenic
1155351884 18:24914987-24915009 CACCAGGTACAAGGGAGGGACGG - Intergenic
1156344425 18:36242836-36242858 CCCCACTCATAAAGGGAGGAAGG - Intronic
1157013152 18:43677429-43677451 CAAAACGCACAAAGGAAGGATGG + Intergenic
1157224455 18:45849906-45849928 CACCAGACATAGAGGGAGGGAGG - Exonic
1160974276 19:1785015-1785037 GACCAGGCACAAAGGCACCAAGG - Intronic
1161038383 19:2097594-2097616 CACCAGGCAGCTGGGGAGGAGGG + Intronic
1161079874 19:2305448-2305470 CACCAGGCACCAAGAGGGTAGGG - Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161422204 19:4182206-4182228 CGACAGGCGCAAAGGGAGGTGGG - Intronic
1163312506 19:16522656-16522678 TACCAAGCACACAGGGAGGGGGG - Intronic
1163648870 19:18505666-18505688 CACCAGGCACACACAGGGGAGGG + Intronic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1164294857 19:23900931-23900953 CACCATGCACAAAGAGAAGATGG + Intergenic
1164722651 19:30443841-30443863 CACCAGCCTCAACGGGAGGGTGG + Exonic
1165013373 19:32864336-32864358 CACCTGGAACACAGAGAGGAAGG + Exonic
1165383035 19:35494502-35494524 CACCGGGCACATAGGGTGGGCGG - Intronic
1165446584 19:35860165-35860187 CTCCTGGCTCAAAGGGAGAAGGG + Intronic
1166934019 19:46320414-46320436 TACAAGGCAGAAAGGGAGGTGGG - Intronic
1167257851 19:48442043-48442065 CACCAGGGTCTGAGGGAGGAAGG + Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1167799420 19:51730496-51730518 CTCCCGGGACTAAGGGAGGAGGG + Intergenic
1167994111 19:53388747-53388769 AACCAGGCAAAAGGGGAGGTTGG + Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
1202693457 1_KI270712v1_random:106541-106563 AACTAGGCACAAAAGGAGCAAGG - Intergenic
925886995 2:8401779-8401801 CACCAGGCCTGCAGGGAGGAAGG + Intergenic
926776988 2:16432564-16432586 CACATGGCACAGAGGAAGGATGG + Intergenic
926918584 2:17916878-17916900 CACCAGGTCCAAAAGGGGGAGGG - Intronic
927994292 2:27472165-27472187 CACCAGGGACTGAGGGAGGCAGG - Intronic
929784256 2:44977779-44977801 CACCATCCACAAAGGGTGGGTGG + Intergenic
929911571 2:46094159-46094181 CAGCAGGCACACAGGGCAGAAGG - Intronic
934311327 2:91868289-91868311 CACCATTCAGAAGGGGAGGAGGG - Intergenic
934979474 2:98828080-98828102 CACCTGGGACAAAGGGATGCTGG + Intronic
935114544 2:100123847-100123869 CACCAGGCACATAAAGAGAATGG + Intronic
935139725 2:100342407-100342429 CACCAGCCACTTAGGGAGGCTGG - Intergenic
936040488 2:109145836-109145858 CACCAGGCTGAAAGGCAGGACGG + Intronic
936722841 2:115274371-115274393 CACCAGGGAAAAAGAGAGGATGG - Intronic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
938134408 2:128742630-128742652 CACCCAGCACAGAGGGAGTAGGG - Intergenic
939733924 2:145819564-145819586 CACAAGGAAGGAAGGGAGGAAGG - Intergenic
943309459 2:186308602-186308624 CAGCAGGCCCACAGGGTGGAAGG + Intergenic
943465015 2:188218153-188218175 TCCCTGGCACAGAGGGAGGAGGG - Intergenic
944155629 2:196604325-196604347 TCATAGGCACAAAGGGAGGAGGG - Intergenic
945879481 2:215311631-215311653 CAACAAACAAAAAGGGAGGATGG + Intergenic
945895154 2:215473041-215473063 TACCAGGGAGAGAGGGAGGAAGG - Intergenic
946016435 2:216607735-216607757 CACCAGGCACACAGTGGGGAGGG + Intergenic
946092831 2:217246067-217246089 CACCAGGCTCTCTGGGAGGAAGG - Intergenic
946143924 2:217714380-217714402 CACAGGGCACACAGGGAGCATGG - Intronic
946229420 2:218282363-218282385 AAGCAGGCGCAAAGGCAGGAGGG - Intronic
947162349 2:227227262-227227284 CACAAGGCACTGGGGGAGGAGGG - Intronic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947529594 2:230900439-230900461 TGCCAGGCACACAGGGTGGACGG + Intergenic
947752870 2:232541862-232541884 CTCCAGGCCCACAGGGAGGCAGG + Intronic
948831401 2:240600021-240600043 CCCCAGGCACAAAGGGACTCAGG - Intronic
949001202 2:241615153-241615175 GACCAGGCAGAAAGGATGGAGGG + Intronic
1169123635 20:3111904-3111926 CACCAGGCACCAAAGAAGGGAGG + Intronic
1169131704 20:3169186-3169208 CCCAAGGCACAAAGGGAAGGAGG - Intronic
1169206915 20:3745733-3745755 TACCAGACAAAAAGGGAGGAGGG - Intronic
1171348998 20:24488541-24488563 CTCCAGGCACAAACTGATGAAGG + Intronic
1172250472 20:33475856-33475878 GGCCAGGCACAGAGGGAGGAGGG + Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173183024 20:40818890-40818912 CACCAAGCAGGAAGGGAGTAGGG + Intergenic
1173540888 20:43849982-43850004 CACCAGGGCCGCAGGGAGGAAGG - Intergenic
1173684945 20:44916736-44916758 CACCTGGGCCACAGGGAGGAAGG - Exonic
1174414203 20:50356513-50356535 ACCAAGGCACAAAGAGAGGAGGG + Intergenic
1174534149 20:51237802-51237824 CACCATGCTCACAGGGAGGGCGG - Intergenic
1174869230 20:54168074-54168096 CACCAGGTGAAAAGGGAGGAAGG - Intronic
1174942579 20:54946951-54946973 CACCAGGCAAAAATCAAGGAAGG + Intergenic
1175319340 20:58074395-58074417 CACCAAGCAGAAAGAGAGGGAGG + Intergenic
1176060509 20:63170426-63170448 CACCAGAGCCAAGGGGAGGAGGG + Intergenic
1176140556 20:63542977-63542999 CCCCAGGCCCCAAGGGCGGAAGG - Intronic
1176173086 20:63705015-63705037 CACCAGGAAGGCAGGGAGGACGG - Intronic
1178723299 21:35029152-35029174 CATCAGGCAGAAAGGAAGAAGGG - Intronic
1178739596 21:35185957-35185979 CTGCAGTCACAAAGGCAGGATGG - Intronic
1179999677 21:44989686-44989708 CCCCAGGCACACAGGAAGGCTGG + Intergenic
1180197075 21:46203381-46203403 CACCAGGCACAAAGTGGGCCAGG + Intronic
1180248094 21:46561951-46561973 TACCAGCCACAAAGGAGGGAAGG - Intronic
1180538086 22:16414197-16414219 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1181893376 22:26084512-26084534 GAACAGCCACATAGGGAGGAGGG + Intergenic
1182503350 22:30764505-30764527 CCCCAGGCACACAGGCAGCAGGG - Intronic
1183173601 22:36205602-36205624 CCCGAGGCACACAGGGTGGAGGG + Intergenic
1183179760 22:36252230-36252252 CCCGAGGCACACAGGGTGGAGGG - Intergenic
1183276477 22:36901213-36901235 CCCCAGGTGCAAAGGTAGGAGGG - Intergenic
1183297318 22:37037871-37037893 CGCCAGGAGCCAAGGGAGGAGGG + Intergenic
1184492944 22:44820623-44820645 CCCCAAGCACAAGGGGAGGGAGG - Intronic
1184536270 22:45089236-45089258 GCCCAGTCACAAAGGGAGGAAGG + Intergenic
1184687596 22:46103675-46103697 CACCAGGCAGATAAGCAGGACGG + Intronic
1184778466 22:46635036-46635058 TACCAACCACAAAGGGACGAAGG - Intronic
1184780934 22:46649088-46649110 CACCAGACAGAATGGGAGCAAGG - Intronic
1184935601 22:47718192-47718214 CACCAGGCAGGAAATGAGGAAGG - Intergenic
1185045435 22:48526225-48526247 CACCACACACAGACGGAGGAGGG - Intronic
949344892 3:3067662-3067684 CACAGGGCAAGAAGGGAGGAAGG + Intronic
949409223 3:3745635-3745657 CAACATGCACAAAGAGAAGATGG - Intronic
949907723 3:8872707-8872729 CACCAGGCAAAAGTGGTGGAGGG + Intronic
952600789 3:35079685-35079707 CACCAGGAATTAAGGCAGGAAGG - Intergenic
952793844 3:37221690-37221712 GAGCAGGCTCAAAGGGAGAAAGG + Intergenic
952951475 3:38528760-38528782 CACCAGGCACTCAGGCTGGATGG + Intronic
953330632 3:42050247-42050269 CACCAGGCACAAATGAAAGTAGG - Intronic
953338675 3:42115813-42115835 CCCCAGCCACAAAGGGACAAGGG - Intronic
955019645 3:55106922-55106944 CTCCAGCCACAAAGGGATGTGGG - Intergenic
955382658 3:58452527-58452549 CACCAGGAATTAAGGTAGGAAGG - Intergenic
956737725 3:72251220-72251242 CACAAGGAACAAAGGAAGGATGG + Intergenic
957822977 3:85401726-85401748 GACCAGACACAAAGGAAAGAGGG + Intronic
959925201 3:111913299-111913321 CTCCTGGAACACAGGGAGGAGGG - Exonic
961048418 3:123725800-123725822 CACAGGGCACAAAGAGAGCACGG - Intronic
961779929 3:129315464-129315486 CACCGCGCACAAAGCGAAGAAGG - Exonic
962635394 3:137326090-137326112 AACCAGGCACAAATGCTGGATGG - Intergenic
966826313 3:183967770-183967792 GACAAGGCACACAGAGAGGAGGG + Intronic
966913426 3:184571679-184571701 CTCCAGGGACCCAGGGAGGAGGG - Intronic
968549983 4:1217157-1217179 CGCCAGGCACACAGGGTGGCCGG + Intronic
968621492 4:1605300-1605322 CCCCAGCCACATGGGGAGGATGG - Intergenic
969207741 4:5660292-5660314 CACCAGGCACTCTGTGAGGAAGG + Intronic
969319783 4:6404735-6404757 CACCAAGCACAAAAGCAGGGAGG + Intronic
969451980 4:7279166-7279188 CACCACCAAAAAAGGGAGGAGGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969644146 4:8416788-8416810 CACCAGGCACACAGGGCAGAGGG + Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970618261 4:17788959-17788981 GACCAGGAACAAAGGTGGGAGGG - Intergenic
970855309 4:20644441-20644463 CACCTAACACAAAGGGAGGCTGG - Intergenic
970991242 4:22215853-22215875 TACCAGGCACAAAGATGGGAGGG + Intergenic
971364269 4:25964988-25965010 CACCAGGCACAGAGGAAGGTGGG - Intergenic
971992956 4:33924934-33924956 CACAAACCACAAAGGGAGGTTGG - Intergenic
973200882 4:47500812-47500834 CACCAGGAAGAAAGTCAGGAGGG + Intronic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
974155251 4:58063278-58063300 CATCAGGCTCAAAGGTTGGATGG + Intergenic
974466063 4:62258111-62258133 AGCCAGGCACAAAGGAAAGATGG - Intergenic
974949194 4:68567893-68567915 CAACAGGTACATAGGAAGGAGGG + Exonic
974958227 4:68670027-68670049 CAACAGGTACATAGGAAGGAGGG + Exonic
975021420 4:69495273-69495295 CAACAGGCACATAGGAAGGAGGG + Exonic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975474147 4:74803038-74803060 TACCAGGAAAAAAGGGAGAATGG + Intergenic
976784530 4:88802886-88802908 CTCCAGTCTCAAAGGAAGGAGGG - Intronic
977116540 4:93035654-93035676 CAACAGCCACAAAGTGAGTATGG - Intronic
977944487 4:102896224-102896246 CACCACTCAGAAGGGGAGGAGGG - Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
980969688 4:139556716-139556738 CTCCCGGCACAACGGGAGGTCGG - Exonic
981065339 4:140477877-140477899 AACCAGGCACAAAATGATGAGGG + Intronic
983922265 4:173358575-173358597 CACCAGGCAGATGGGAAGGAAGG + Intergenic
984806718 4:183758132-183758154 CACAAGGCAGAAGGGGAGGCTGG + Intergenic
985179332 4:187239555-187239577 AGGCAGGTACAAAGGGAGGAAGG - Intergenic
985273975 4:188219661-188219683 CACCAGGCACACAGGCCTGAGGG - Intergenic
985299685 4:188474992-188475014 CACTAAGCACAAGAGGAGGAAGG - Intergenic
988676934 5:33441826-33441848 CACCAGGTAAACAGGCAGGACGG + Intronic
989158139 5:38364386-38364408 TACCAGGCAAAAGGGGAGGGAGG + Intronic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990453611 5:55961373-55961395 CTCTAGGCCCAAAGGGATGAGGG + Intronic
990598767 5:57336618-57336640 GACCAGGGACAAAAGGAGGCTGG - Intergenic
992296944 5:75335132-75335154 CACAAGGTAGAAAGGGAGGGTGG - Intergenic
993847045 5:92957098-92957120 CCCCAGGCACAGAGGAAGCAGGG - Intergenic
993916787 5:93753908-93753930 TACCAGGCACACAGGATGGAAGG - Intronic
994489905 5:100427828-100427850 CACAAGGAAGGAAGGGAGGAAGG - Intergenic
997304317 5:132826691-132826713 TAACAGGCACAGAGGGAGGGAGG - Intronic
997481264 5:134186378-134186400 CAGCAGTCAAAAAGGCAGGAGGG + Intronic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998384305 5:141747636-141747658 CACCAGACACAGAGAAAGGAGGG + Intergenic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
999279278 5:150354356-150354378 AAGCAGGAACAAAGAGAGGATGG - Intergenic
1000027526 5:157372835-157372857 CACCACGGCCAATGGGAGGAGGG - Intronic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1001330965 5:170762036-170762058 CCACAGGCACAAAGGAGGGAGGG + Intergenic
1002641839 5:180634124-180634146 CAACAGGCACTTTGGGAGGATGG - Intronic
1003098365 6:3158820-3158842 GACCAGCCACAAAGCTAGGAAGG + Intergenic
1003132110 6:3403578-3403600 CAGCAGCCACACAGCGAGGAAGG + Intronic
1004444171 6:15682796-15682818 CATCAGCCAAAAAGGAAGGATGG + Intergenic
1004792931 6:19048904-19048926 CAGCAGGCAGAAAGGCAGCAAGG - Intergenic
1005302172 6:24481681-24481703 CAGCAGCCACAAGGGGAAGAGGG - Intronic
1006419352 6:33923710-33923732 AACCAGGCACCCAGGGAGGCAGG - Intergenic
1008485491 6:52030642-52030664 CACCATCCAGAAAGGGAAGAAGG + Intronic
1008671005 6:53768736-53768758 CACAAAGCACAAAGGGTGGGTGG + Intergenic
1008857292 6:56105214-56105236 CATCAGGTTCAAAGAGAGGACGG - Intronic
1009192805 6:60650005-60650027 CACCAAGCACAGAGGTGGGAAGG - Intergenic
1009301595 6:62031107-62031129 CACCAGGGACCAGGGGTGGAGGG + Intronic
1009816723 6:68746674-68746696 GACCAGGGACAAGGGGAAGAGGG - Intronic
1010038511 6:71354566-71354588 CACCCAGCACCAAGGAAGGAAGG + Intergenic
1011822294 6:91267953-91267975 CACCAGGCACAAAAGGCCAAAGG - Intergenic
1014786799 6:125628578-125628600 CACGAGGCATCAAGGGAGGACGG + Intergenic
1014986509 6:128017650-128017672 CAACAGGCAGAAAGAGAGGTTGG - Intronic
1015825277 6:137304511-137304533 AACAAGGAACAAAGGGAGGGAGG + Intergenic
1017307171 6:152932204-152932226 CACCATCCAGAAAGGGAGGAGGG - Intergenic
1018379231 6:163242563-163242585 CACCAGGCACAGAAGGGTGATGG + Intronic
1018739735 6:166718224-166718246 CTCCAGGCACAAAGGGAACTAGG + Intronic
1019736276 7:2651257-2651279 CTCCAGGGACAAAGGGTGGCAGG - Intronic
1019764148 7:2837190-2837212 CACGAGGCAGAAAGAGGGGATGG + Intronic
1019901649 7:4025865-4025887 CACAAGGCAGAAAGACAGGAAGG - Intronic
1022148403 7:27571641-27571663 TACCAGACACAAAGGGAGACAGG - Intronic
1022389904 7:29934614-29934636 GCCCAGACACAAAGGGAAGACGG + Intronic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1023694185 7:42827825-42827847 CTAAAGGCACAAAGAGAGGAGGG + Intergenic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1027191837 7:76001038-76001060 ACCCAGGCCCACAGGGAGGAGGG - Intronic
1028230078 7:88296599-88296621 CACAAGGCAAAAGGGCAGGAGGG + Intronic
1029197573 7:98816563-98816585 CACCAGGCACAGAGAGAGGTAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029706086 7:102276782-102276804 TACCAGGCAGTAGGGGAGGAGGG + Intronic
1031360470 7:120843603-120843625 CACAAGGCACAAAGAGAGATGGG - Intronic
1032005636 7:128300175-128300197 AACCAATCACAAAGAGAGGAGGG - Exonic
1033223227 7:139542533-139542555 CACCTGGCCGCAAGGGAGGATGG + Intronic
1034257762 7:149733834-149733856 CAGCAGGCACTAAAGGGGGAAGG - Exonic
1034837150 7:154363056-154363078 CACCAAGAACAATGGGTGGAGGG - Intronic
1034899258 7:154897416-154897438 CAGCAGGAAAAAAGGGCGGAAGG - Intergenic
1034909797 7:154986359-154986381 CACCAGGTACAGAAGCAGGAGGG - Intronic
1035631570 8:1110841-1110863 CACCAGGCACAGAGGGTGTGTGG - Intergenic
1036461184 8:8954265-8954287 CAACAGGCACACAGAGGGGAAGG - Intergenic
1036689972 8:10939215-10939237 AACCAGGCAAGAAGGAAGGAAGG + Intronic
1039561640 8:38517029-38517051 TACCAGGTTCAAAGTGAGGAAGG + Intronic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1044274791 8:90286431-90286453 CACCAGGAAAAAAGGGAGGGAGG - Intergenic
1045832241 8:106476527-106476549 CACCAGGATTAAAGGCAGGAAGG - Intronic
1047064413 8:121264376-121264398 CACAAGGCACAATGGGAACATGG + Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1050182363 9:2934574-2934596 AGCCAGACTCAAAGGGAGGACGG + Intergenic
1055354760 9:75426463-75426485 AACTAGGCAGAAAGGAAGGAAGG + Intergenic
1057832990 9:98420742-98420764 CACCAGGCAAAAGGGAAGGTTGG + Intronic
1059402788 9:114081175-114081197 CAGCAGCCAGAAGGGGAGGAGGG - Intergenic
1059523024 9:114961741-114961763 CACCAGGCACAGTTGGAAGAAGG + Intergenic
1060245461 9:121942168-121942190 CACCAGACACAAAGGTAACATGG - Intronic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1061272679 9:129552349-129552371 AACCAGCCAGCAAGGGAGGACGG + Intergenic
1061791930 9:133063563-133063585 CACCATGCACCACGGGAAGAGGG + Intronic
1061903521 9:133684955-133684977 CACCAGGCACCGAGGAGGGATGG + Intronic
1186173824 X:6904552-6904574 CACCAGGCTCAGAAGGATGAGGG + Intergenic
1186240542 X:7560895-7560917 CTCCAGGGACAATGGGAGGGTGG - Intergenic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1190003279 X:46710006-46710028 CTCCAGGGAGAAAGGGAGGCCGG + Intronic
1190832037 X:54067466-54067488 CACCAGAAACAAAGGGAGAAAGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1192216654 X:69164118-69164140 CAGCAGGCACAAATGGAAGCGGG + Intronic
1196178337 X:112664596-112664618 CACCTGTCTAAAAGGGAGGATGG - Intronic
1196907183 X:120449230-120449252 CCCCAGGCACAAAGTGACAAAGG + Intronic
1198645898 X:138806331-138806353 CACCTGGCACGCAGTGAGGATGG - Intronic
1200010097 X:153114315-153114337 CACCAGGCACACAGAGAGGTAGG - Intergenic
1200029503 X:153285607-153285629 CACCAGGCACACAGAGAGGTAGG + Intergenic
1200071299 X:153530773-153530795 TACCAGGAACAGGGGGAGGAAGG + Intronic