ID: 1096781054

View in Genome Browser
Species Human (GRCh38)
Location 12:53992333-53992355
Sequence CTATAGAAGGGGAAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 819}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096781054_1096781061 -10 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781061 12:53992346-53992368 CCTTCTATAGCTCCATCTCCAGG 0: 2
1: 0
2: 0
3: 12
4: 184
1096781054_1096781067 7 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781067 12:53992363-53992385 TCCAGGGGAAGGACATGTTTGGG 0: 1
1: 0
2: 0
3: 25
4: 192
1096781054_1096781063 -8 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781063 12:53992348-53992370 TTCTATAGCTCCATCTCCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 142
1096781054_1096781072 25 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781072 12:53992381-53992403 TTGGGGTGTTGGTAGGTTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 243
1096781054_1096781064 -4 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781064 12:53992352-53992374 ATAGCTCCATCTCCAGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1096781054_1096781062 -9 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781062 12:53992347-53992369 CTTCTATAGCTCCATCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 195
1096781054_1096781070 14 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781070 12:53992370-53992392 GAAGGACATGTTTGGGGTGTTGG 0: 1
1: 1
2: 0
3: 31
4: 302
1096781054_1096781066 6 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781066 12:53992362-53992384 CTCCAGGGGAAGGACATGTTTGG 0: 1
1: 0
2: 1
3: 25
4: 224
1096781054_1096781071 18 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781071 12:53992374-53992396 GACATGTTTGGGGTGTTGGTAGG 0: 1
1: 0
2: 1
3: 9
4: 254
1096781054_1096781069 8 Left 1096781054 12:53992333-53992355 CCTTTCCCCTTCCCCTTCTATAG 0: 1
1: 0
2: 7
3: 76
4: 819
Right 1096781069 12:53992364-53992386 CCAGGGGAAGGACATGTTTGGGG 0: 1
1: 0
2: 0
3: 30
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096781054 Original CRISPR CTATAGAAGGGGAAGGGGAA AGG (reversed) Intronic
900685895 1:3947455-3947477 CCAGAGACCGGGAAGGGGAAGGG - Intergenic
900830117 1:4959865-4959887 AGACAGAAGGGGAGGGGGAAGGG + Intergenic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
902260703 1:15222760-15222782 GAAAGGAAGGGGAAGGGGAAGGG + Intergenic
902630210 1:17700381-17700403 CTGGAGAAGGGGGATGGGAAGGG + Intergenic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
902905968 1:19557753-19557775 GAATTGAAGGGGAAGGGGAAGGG - Intergenic
902905982 1:19557793-19557815 GAACAGAAGGGGAAGGGGAAGGG - Intergenic
902905993 1:19557821-19557843 GTAGGGAAGGGGAAGAGGAAGGG - Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903344852 1:22677397-22677419 CCCTACAAGGGGAAGGGGAAAGG + Intergenic
903836174 1:26204580-26204602 GTAGGGAAGGGGAAGGGGAAGGG - Intergenic
904211356 1:28888300-28888322 CTATTGAAGGGGAGCGGGAGGGG + Intronic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
904565352 1:31425307-31425329 CTACAGAAGGGGTCGGGGAATGG - Intronic
904599112 1:31664153-31664175 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
904608701 1:31713560-31713582 CTTGAGATGGGGAAGGGGAATGG + Intergenic
905051050 1:35051505-35051527 CTACAGAAGGGCAAGAAGAATGG - Intergenic
906427780 1:45727439-45727461 GAAGAGAAGGGCAAGGGGAAGGG - Intronic
907074126 1:51563652-51563674 CTATGGATGGGGAGTGGGAAAGG - Intergenic
907208917 1:52801138-52801160 AAATAAAAAGGGAAGGGGAAAGG + Intronic
908252473 1:62275888-62275910 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
910660778 1:89670084-89670106 TTAAATAAGGGGAATGGGAAAGG - Intronic
910974152 1:92888191-92888213 CTAGAGGTGGGGAAGGGTAAGGG - Intronic
911048770 1:93651797-93651819 TTATAAAAGGGGGAGGGGAAGGG - Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911302788 1:96195685-96195707 TGAAAGAAGGGAAAGGGGAAGGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912667392 1:111594507-111594529 GGAAGGAAGGGGAAGGGGAAAGG + Intronic
912959381 1:114181552-114181574 CTACAGATGGGGGAGGGGAGAGG + Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913296170 1:117322754-117322776 GGATTGAAAGGGAAGGGGAAAGG + Intergenic
915356009 1:155255463-155255485 CTAGAGAAGGGGGATGGGAATGG + Intronic
915520485 1:156439566-156439588 CGAAAGAGGGGGAGGGGGAAAGG + Intergenic
915794314 1:158711450-158711472 CTAGAGACGGGGAAGGGAAGTGG - Intergenic
916165219 1:161960832-161960854 TTACAGAATGGGAAGGGGCAGGG - Exonic
916476121 1:165170624-165170646 AGATGGAAAGGGAAGGGGAAAGG - Intergenic
918328996 1:183438192-183438214 GGAAGGAAGGGGAAGGGGAAAGG + Intergenic
918451693 1:184664808-184664830 CCAGAGGAGGGGATGGGGAAGGG + Intergenic
918780761 1:188697178-188697200 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
918780771 1:188697217-188697239 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
920187061 1:204166345-204166367 GTATAAAAGGGGAAGGGCTAAGG - Intergenic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920330253 1:205202125-205202147 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
920344578 1:205298115-205298137 TTAAAGTAGGGGAAGGGGAGTGG - Intergenic
920523091 1:206643814-206643836 AGAGAAAAGGGGAAGGGGAAGGG + Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
921562724 1:216677584-216677606 ATAGAGAAAGGGAAAGGGAAAGG + Intronic
921907320 1:220508848-220508870 AAATGGAAGGGGAAGGAGAAAGG + Intergenic
922023353 1:221727029-221727051 CTATAAAATGGGGAGGGTAATGG - Intronic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922353552 1:224755730-224755752 CTTTCGGAGGGGAATGGGAAGGG - Intergenic
922469790 1:225868952-225868974 CTACAGAGGGAGAAGGGGCAGGG + Intronic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923210495 1:231799866-231799888 GGAGGGAAGGGGAAGGGGAAGGG - Intronic
923243680 1:232110588-232110610 CCTTAGGAGGGGAAAGGGAATGG - Intergenic
924262898 1:242250386-242250408 CCCTGGAAGGTGAAGGGGAATGG + Intronic
924367181 1:243307285-243307307 CTAAAGAAAGGGCTGGGGAATGG - Intronic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
1063207580 10:3849128-3849150 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1065292558 10:24245620-24245642 AAAAGGAAGGGGAAGGGGAAGGG - Intronic
1065796366 10:29311954-29311976 GTCAAGAAAGGGAAGGGGAAGGG + Intronic
1065975807 10:30841441-30841463 CTATAACAGGGGCAAGGGAAGGG + Intronic
1066198987 10:33127994-33128016 GGAAAGAAGGGGAAGGGGAGGGG - Intergenic
1066334514 10:34462871-34462893 AAAGAGAAGGGGAAGGGAAAGGG + Intronic
1066334608 10:34463136-34463158 AAAGAGAAGGGGAAGGGAAAGGG + Intronic
1066334634 10:34463213-34463235 AAAGAAAAGGGGAAGGGGAAGGG + Intronic
1066413911 10:35201315-35201337 CTTAAGGAGGGGAAGAGGAAGGG + Intronic
1066721888 10:38348068-38348090 CCCTGGAAGGTGAAGGGGAATGG - Intergenic
1067893977 10:50160208-50160230 CTATTTAGGGGAAAGGGGAAAGG - Intergenic
1068078100 10:52283292-52283314 CTAGAGTAGGGCAAGGGCAATGG + Intronic
1068109626 10:52664588-52664610 CTGGAGCAGAGGAAGGGGAAGGG + Intergenic
1068317392 10:55364165-55364187 TGGCAGAAGGGGAAGGGGAAGGG - Intronic
1068345213 10:55768583-55768605 GTATAGAAAGGGAAAGGAAAAGG + Intergenic
1068897193 10:62219057-62219079 CAAAAGAAGGGGAGGAGGAAGGG - Intronic
1069873814 10:71549348-71549370 ATATAGGAGGGGAGGGGGCACGG + Intronic
1070025234 10:72625948-72625970 TTAGGGAAGGCGAAGGGGAAGGG - Intronic
1070543289 10:77432845-77432867 TTACAGAGGGGGAAGGGGCAGGG + Intronic
1071792164 10:88966317-88966339 TTATAGACAGGGAAGGGGATTGG + Intronic
1071913157 10:90258516-90258538 ATATGGAATGGGAAGGAGAAGGG + Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072316745 10:94210914-94210936 CTACAGAAGGGAAAGGGCAGAGG - Intronic
1072564992 10:96609969-96609991 CATGGGAAGGGGAAGGGGAAGGG + Intronic
1072645497 10:97251200-97251222 AAAGGGAAGGGGAAGGGGAATGG + Intronic
1072645688 10:97251667-97251689 GAAGGGAAGGGGAAGGGGAAAGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073196374 10:101694978-101695000 CGAAGGAAGGGGAAGGGGAAGGG - Exonic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073712273 10:106057206-106057228 ATAAAGAAGGGGAAAGGGAAAGG - Intergenic
1073972821 10:109063889-109063911 CCTCAGAAGGGAAAGGGGAAGGG - Intergenic
1074398063 10:113116197-113116219 CTACAAAAGGGGAAGGGGAAGGG - Intronic
1074577551 10:114684600-114684622 CTTTAGAAGTGGTAGGGGCAGGG - Intronic
1074924447 10:118053184-118053206 GAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1075180630 10:120207653-120207675 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1077151841 11:1076298-1076320 CAATAGCTGGGGATGGGGAAGGG - Intergenic
1077620558 11:3718580-3718602 GAAAAGAAGCGGAAGGGGAAAGG + Intronic
1077806594 11:5596553-5596575 CTGGAGATGGGGGAGGGGAAGGG - Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078362566 11:10680531-10680553 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1078516673 11:12028417-12028439 TTATAGAATGGTAAGGTGAAGGG - Intergenic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079150686 11:17896615-17896637 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1079836064 11:25334274-25334296 ATATTCAAGGGGAAGTGGAAAGG + Intergenic
1080157402 11:29127901-29127923 AAAGGGAAGGGGAAGGGGAAAGG + Intergenic
1080438540 11:32268922-32268944 GAAGGGAAGGGGAAGGGGAATGG + Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081358477 11:42143734-42143756 CAATAGGAGTGGAAGGTGAAGGG + Intergenic
1081468145 11:43344353-43344375 CTTAGGAAAGGGAAGGGGAAGGG - Intronic
1081534291 11:43986110-43986132 TGAGAGAAGGGGAAGAGGAATGG - Intergenic
1081699021 11:45140795-45140817 CTAGAGAAAGGGATGGGGACTGG - Intronic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082801673 11:57419481-57419503 CTCTAGAGTTGGAAGGGGAAAGG - Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084985726 11:72869378-72869400 CAAGAGAAGGGGAAAGGGAGGGG + Intronic
1085278742 11:75316497-75316519 CGACAGAAGGGAAAGAGGAATGG + Intronic
1085460574 11:76690629-76690651 ATATAGATGGGGTTGGGGAAGGG - Intergenic
1086518685 11:87645902-87645924 CAAGAGAAGGGGGAAGGGAAGGG - Intergenic
1086595901 11:88570041-88570063 AAAGAGAAGGGGAAGGGGAAAGG + Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1087095754 11:94315893-94315915 CTAGAGTAAGGGAGGGGGAAGGG - Intergenic
1087259187 11:95991724-95991746 CTAAAGAAGAGAAAGGGGGAAGG + Intronic
1087423915 11:97966390-97966412 CTAGAGAAGGGAAAAGAGAAGGG + Intergenic
1087474839 11:98622152-98622174 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1087640265 11:100749072-100749094 CTAGGGAAGGGGAAGGAGAGGGG - Intronic
1088020654 11:105114168-105114190 CCAGAGAAGAGGATGGGGAATGG + Intergenic
1088233841 11:107701360-107701382 CTTTAGCAGGGGAAAGGGATAGG - Intergenic
1088598695 11:111457573-111457595 GTAGAGATGGGGAAGGGGAGAGG - Intronic
1088648381 11:111936695-111936717 CTAAAGAAGAGGAAGCAGAAGGG - Intronic
1088853833 11:113728590-113728612 CTAAAGCAGGGAATGGGGAATGG + Intergenic
1089282000 11:117381238-117381260 CCCTAGAAGGGGAAGGAGAATGG + Intronic
1090062706 11:123477646-123477668 AGAGAGAAGGGAAAGGGGAAGGG - Intergenic
1090201800 11:124862930-124862952 CTAGAGAATGGGAAGGAAAAGGG + Intergenic
1090346488 11:126075835-126075857 AGATTGAAGGGGAAGGGAAATGG - Intergenic
1090505380 11:127306905-127306927 AAAGGGAAGGGGAAGGGGAAAGG - Intergenic
1090742895 11:129682167-129682189 CTAGAAAGGGGAAAGGGGAAGGG + Intergenic
1091158300 11:133394558-133394580 CTATAGCATGGGAAGGGTAGTGG - Intronic
1091192426 11:133706841-133706863 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1091192576 11:133707362-133707384 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1091192751 11:133707877-133707899 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1091477015 12:784983-785005 CTATTAAAGAGGAAAGGGAAAGG - Intronic
1091726456 12:2849584-2849606 GGAGAGACGGGGAAGGGGAAGGG + Intronic
1091939592 12:4466302-4466324 CCAGAGACTGGGAAGGGGAAGGG + Intergenic
1092160238 12:6311777-6311799 CTTTATATGGGGAAGGGGATGGG + Intronic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092388023 12:8050926-8050948 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1092388088 12:8051093-8051115 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1092456888 12:8651903-8651925 CTTTAGAAAGGAAAGGAGAAAGG - Intronic
1092462778 12:8700422-8700444 CACTAGTAGGGGATGGGGAAAGG + Exonic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1092798718 12:12141133-12141155 GGAAAGAAGGGGAAGGAGAAGGG + Intronic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1093347226 12:18053184-18053206 CATTAGAAGGGTAAGAGGAACGG - Intergenic
1093421485 12:18979347-18979369 ACAGAGATGGGGAAGGGGAAAGG - Intergenic
1093507541 12:19885954-19885976 ATAGAGAAGGGCAAGAGGAAGGG - Intergenic
1094047381 12:26182570-26182592 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1094290684 12:28845752-28845774 CTATTTAAGAGGAAGAGGAAGGG - Intergenic
1094525166 12:31226588-31226610 CCCTAGGAGGGGAAGGGGAGGGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1096659917 12:53118035-53118057 AGACAGAAGGGGAAGGAGAATGG + Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1096823957 12:54259897-54259919 CAACTGAAGGGGGAGGGGAAAGG + Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097210824 12:57368291-57368313 CTAACTAAGAGGAAGGGGAAGGG - Intronic
1097237340 12:57549502-57549524 CTTTGGATGTGGAAGGGGAAGGG + Intergenic
1097312522 12:58136169-58136191 CTATTGAGGGGGCAGTGGAAGGG - Intergenic
1097386252 12:58952897-58952919 CTAAAGAAGGTGGAGGGGAGTGG + Intergenic
1097697326 12:62787203-62787225 CTGGAGACAGGGAAGGGGAAAGG + Intronic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1098304539 12:69089628-69089650 CTAGAGAAGGGAGAGGGGAAGGG - Intergenic
1098628156 12:72698414-72698436 CTATACCAGGGGTAGGGGATGGG + Intergenic
1098761221 12:74427683-74427705 CTGTAGAGGGGTAGGGGGAAAGG - Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099679543 12:85807341-85807363 CTAAAGTAGGGGATGGAGAAAGG - Intronic
1100268769 12:93003624-93003646 CTAGAGAAGGTGCAGGGGAGGGG + Intergenic
1101075132 12:101121219-101121241 CTATAGAGGGGAGAGGGGGAGGG - Intronic
1101274493 12:103184544-103184566 CTATAGATGAGGGTGGGGAATGG + Intergenic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102558052 12:113741931-113741953 AGAGAGAAGGGGAAGGGAAAAGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103007414 12:117432600-117432622 CTAATGAAGTGGAAGGGAAATGG + Intronic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103909786 12:124345861-124345883 CTTGTGAAGGGGAAGGAGAATGG - Intronic
1104515646 12:129423560-129423582 CCACAGGAGGGGAAGGGGACTGG + Intronic
1104664577 12:130638652-130638674 CAACAGATGGGGAGGGGGAAAGG - Intronic
1105727298 13:23177206-23177228 CCAGAGAATGGGGAGGGGAAGGG + Intergenic
1106684871 13:32047995-32048017 ATGTAGAAAGGGTAGGGGAAGGG - Intronic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107568425 13:41630533-41630555 AGATAGAAGGGGAGGGGGAGTGG - Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1108119762 13:47172000-47172022 CCATGGAAGGAGTAGGGGAATGG + Intergenic
1108518759 13:51225912-51225934 CTATAGAAGGGGGAAGGAGAAGG + Intronic
1108637738 13:52352180-52352202 ATATAAAAGGGGAAGGGGCTGGG + Intergenic
1109267878 13:60221622-60221644 CAATAGAAGGGTAAGGAGGACGG - Intergenic
1110690252 13:78424176-78424198 AATTGGAAGGGGAAGGGGAAGGG + Intergenic
1110721641 13:78768646-78768668 CTGAAGAAGGGGAATGGGAGTGG + Intergenic
1111815766 13:93150451-93150473 CTAGAGAAGGCAAAGGGGCAGGG + Intergenic
1111963180 13:94833825-94833847 CTATTCAAAGGGAAGGAGAAGGG + Intergenic
1112015733 13:95330039-95330061 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1112217854 13:97453376-97453398 CTAAGGATGGGGAAGGGGAATGG - Intronic
1112550924 13:100419546-100419568 TTATAGAAGGTTATGGGGAAAGG + Intronic
1114248217 14:20934412-20934434 CTAGAGAAGTGGGAGGAGAAGGG - Intergenic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114540119 14:23449088-23449110 CTAGAGAAGAGAAAGGGGAAGGG + Intergenic
1114679184 14:24469925-24469947 CTAGAGAAGGGGGTGGGGAGAGG + Intergenic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115724489 14:36198463-36198485 TACTAGAAGGGGAAGGGGAATGG + Intergenic
1116904181 14:50389168-50389190 TTATAGAAGGGACAGGGGCATGG - Intronic
1117071638 14:52062712-52062734 GAATTGAAGGGGATGGGGAAGGG + Intronic
1117349305 14:54865677-54865699 GTATGGAAGAGGAAGGAGAACGG + Intronic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117841783 14:59869280-59869302 CCAGAGGAGGGGAAGGGGAGTGG - Intronic
1117993036 14:61453635-61453657 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118710723 14:68517240-68517262 AAAGGGAAGGGGAAGGGGAAGGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1118837930 14:69489708-69489730 CTATAGAGTGGGAATGGGATGGG + Intronic
1120103134 14:80466805-80466827 CCACAGAAAGGAAAGGGGAAGGG + Intergenic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1120826744 14:88963052-88963074 CTATCCGAGGGGAAGGAGAAGGG - Intergenic
1121436845 14:93926111-93926133 CAGTAGAAGGGGAAGAGAAAAGG + Intronic
1121593360 14:95137482-95137504 ATAGGGAAGGGGAAGGGAAAGGG + Intronic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1121613630 14:95298208-95298230 CTATTGGGGGGGAAGGGGAAGGG - Intronic
1121769880 14:96524487-96524509 GAAGGGAAGGGGAAGGGGAACGG - Intronic
1122275801 14:100590201-100590223 CTAGAGAATGGGAAGGTGAGAGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122415709 14:101548613-101548635 AGATAGAAGGGGAAGAGGGAAGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1124019941 15:25911166-25911188 TTATAAAAGGGAGAGGGGAATGG + Intergenic
1124200488 15:27674828-27674850 CCACAGAGGGGGAAGAGGAAAGG - Intergenic
1125243114 15:37599781-37599803 CTATAGAAGATGATGGTGAAAGG - Intergenic
1125333152 15:38601962-38601984 CGGGAGAAGGGCAAGGGGAAGGG - Intergenic
1126370400 15:47939818-47939840 CTATGGAAAGAAAAGGGGAAAGG + Intergenic
1126687298 15:51259544-51259566 CTAAGGAAGGGTCAGGGGAAGGG + Intronic
1126932380 15:53669035-53669057 GGAAAGAAGGGGAAGGGGAGGGG + Intronic
1127446393 15:59067355-59067377 AGGAAGAAGGGGAAGGGGAAGGG - Intronic
1127597061 15:60495830-60495852 CCCTAGTGGGGGAAGGGGAAAGG - Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1127978517 15:64016801-64016823 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1128115790 15:65104251-65104273 CGAAAGGAAGGGAAGGGGAAGGG + Intronic
1128211938 15:65909182-65909204 GTATAGCAGGGGAAGGGGGTAGG + Intronic
1128705128 15:69832611-69832633 AAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1128794314 15:70453611-70453633 AGAAAGAAGGGGAAAGGGAAGGG - Intergenic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129372063 15:75103724-75103746 GAAAAGAAAGGGAAGGGGAAGGG - Intronic
1130091304 15:80823549-80823571 TTACAGAAGGGGAAAGGGACTGG - Intronic
1130171629 15:81520565-81520587 AAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1130360855 15:83184598-83184620 ATAAAGAATGGGAAAGGGAAAGG - Intronic
1130552622 15:84900823-84900845 AGACAGAAAGGGAAGGGGAAGGG + Intronic
1130552624 15:84900829-84900851 AAAGGGAAGGGGAAGGGGAAAGG + Intronic
1130643825 15:85706058-85706080 CTGTAGAAGGGAAAGAGAAATGG + Intronic
1130703003 15:86204505-86204527 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1131641581 15:94299041-94299063 CAAAGGGAGGGGAAGGGGAAGGG - Intronic
1132026632 15:98409151-98409173 CAGGAGAAGAGGAAGGGGAAGGG + Intergenic
1132267881 15:100492967-100492989 ACAAAGAAGGGGACGGGGAATGG - Intronic
1132325768 15:100968798-100968820 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1133982410 16:10642819-10642841 CTACAGGCTGGGAAGGGGAAGGG + Intronic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134584603 16:15398936-15398958 CAATGAAAGGGGAAGTGGAAGGG + Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1135186105 16:20317062-20317084 GAAGAGAAGGGAAAGGGGAAGGG - Intronic
1135244487 16:20843863-20843885 CTAAAGAAGGGGTTGGGGAAAGG - Intronic
1135624297 16:23981814-23981836 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1135624340 16:23981903-23981925 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1135624393 16:23982049-23982071 AAAGAGAAGGGGAAGGGAAAGGG - Intronic
1135624507 16:23982354-23982376 CAAGGGAAAGGGAAGGGGAAGGG - Intronic
1135850285 16:25957268-25957290 CCAGAGAAGAGGCAGGGGAAGGG - Intronic
1135963429 16:27016463-27016485 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136494710 16:30635257-30635279 CTATAGAAGGACTCGGGGAAAGG + Intergenic
1137323115 16:47406735-47406757 CTAAAGAAGGGTAAGGGCAAAGG + Intronic
1137546484 16:49408080-49408102 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1137878577 16:52021914-52021936 GTAGAGAAGATGAAGGGGAAAGG - Intronic
1138227294 16:55307628-55307650 CCATATCATGGGAAGGGGAATGG + Intergenic
1138262875 16:55637972-55637994 CTGAAAAACGGGAAGGGGAATGG + Intergenic
1138339844 16:56281505-56281527 AGATAGAAGGGGAGGGGAAAGGG - Intronic
1138458803 16:57135948-57135970 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1139093511 16:63677211-63677233 TTAGAGAAGGGTAATGGGAAAGG + Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139741808 16:69041698-69041720 CTATACAAGGTGGAGGAGAAGGG - Intronic
1139877501 16:70157880-70157902 CTTTAGAATAGGGAGGGGAAGGG + Exonic
1139950561 16:70666280-70666302 CCATAGAAGGGGGTGGGGGAAGG + Intronic
1140020260 16:71231540-71231562 CTATAGAAGAGCAAGGGAGAGGG + Intergenic
1140169496 16:72588850-72588872 TTATGGAAGGGTAAAGGGAAAGG - Intergenic
1140328700 16:74030775-74030797 CCATAGAGGGGGGAGGGAAAAGG - Intergenic
1140352026 16:74271379-74271401 CTGTAGTAGGGGATGGGGAGGGG - Intergenic
1140455097 16:75100382-75100404 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1140788704 16:78368686-78368708 CATTAGAGGGGGGAGGGGAAGGG - Intronic
1141274856 16:82578156-82578178 CAATTGATGGGGAAGGAGAAAGG + Intergenic
1141308217 16:82887322-82887344 GTAAAGAATGGGAAAGGGAATGG + Intronic
1141388741 16:83646882-83646904 CATTAGCAGGTGAAGGGGAAAGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142551231 17:741275-741297 CAATAGAAGAGGAAGGAAAAAGG - Intronic
1142983093 17:3682542-3682564 CTGGAGAAGGGGATGGGGACTGG + Intronic
1143216462 17:5228892-5228914 CTATAGCAGGGGAAAGAGACTGG - Intronic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144560962 17:16320118-16320140 AAAGGGAAGGGGAAGGGGAAAGG + Intronic
1144746809 17:17621460-17621482 GAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1145287466 17:21516957-21516979 ACCTAGAAGGGGAAGGGGAAGGG + Intergenic
1145302096 17:21648011-21648033 CCACAGAAGGGGAAGGGCTAGGG - Intergenic
1145348214 17:22055305-22055327 CCACAGAAGGGGAAGGGCTAGGG + Intergenic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1146497792 17:33338279-33338301 CTCTGGAAGGGCAAGGAGAATGG + Intronic
1146930101 17:36770885-36770907 AGGTTGAAGGGGAAGGGGAAGGG - Intergenic
1147514285 17:41101585-41101607 GGAGAGAAGGGGAAGGGGAAGGG + Exonic
1147754183 17:42757367-42757389 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149835211 17:59906359-59906381 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150963282 17:69938243-69938265 CTATAGTAGGTGATAGGGAAAGG + Intergenic
1151386422 17:73757902-73757924 GGAGAGGAGGGGAAGGGGAAGGG - Intergenic
1151661165 17:75519055-75519077 ATATGGAAGGGGAACAGGAAGGG - Intronic
1152609199 17:81307399-81307421 GGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1152609225 17:81307455-81307477 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1203193035 17_KI270729v1_random:206973-206995 CCACAGAAGGGGAAGGGCTAGGG - Intergenic
1203202399 17_KI270730v1_random:6408-6430 CCACAGAAGGGGAAGGGCTAGGG - Intergenic
1152960025 18:74025-74047 GAAAGGAAGGGGAAGGGGAAGGG + Intergenic
1153708475 18:7772432-7772454 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1153862548 18:9227956-9227978 CCAGAGAATGGGAAGGGGATTGG - Intronic
1154072822 18:11168706-11168728 CTAGACACTGGGAAGGGGAAAGG - Intergenic
1155623041 18:27802981-27803003 GAATGGAAGGGGAAAGGGAAGGG + Intergenic
1157091410 18:44641205-44641227 CCATGGAATGGGAATGGGAATGG + Intergenic
1157331913 18:46710479-46710501 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1157403978 18:47408428-47408450 CCTGAGAAGGGGAAGGGGAAGGG + Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157830490 18:50852769-50852791 CTAGACCAGGGGAATGGGAATGG - Intergenic
1158409629 18:57193980-57194002 CTAGAGGTGGGGATGGGGAAGGG - Intergenic
1158423104 18:57313430-57313452 AGAAAGAAGGGGAGGGGGAAGGG + Intergenic
1159624686 18:70679028-70679050 AAAGAGAAGAGGAAGGGGAAGGG - Intergenic
1160373387 18:78392202-78392224 TTGTAGAAGGGGAACGAGAAAGG + Intergenic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1160967279 19:1752344-1752366 TTCTAGAAGAGGAAGGGGATGGG - Intergenic
1161821562 19:6533606-6533628 CTTTGGAGGGGGAGGGGGAAGGG - Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162119159 19:8451530-8451552 CAAGGGAAGGGGAAGGGGAAGGG - Intronic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1162790285 19:13059306-13059328 AGAGAGAAGGGGAAGGGGAGAGG - Intronic
1163117659 19:15197967-15197989 TAATAGAAGGGGAAGGGGCAGGG + Intronic
1163235663 19:16029099-16029121 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1163637894 19:18445871-18445893 CTATAGCAGGGGGAGGTGACAGG - Intronic
1164680563 19:30131213-30131235 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1164976526 19:32577010-32577032 GAAGAAAAGGGGAAGGGGAAGGG - Intergenic
1165545809 19:36534962-36534984 CTAAAGCAGGAGAAGAGGAAGGG + Intronic
1165564163 19:36709491-36709513 CTGGAGTGGGGGAAGGGGAAGGG - Intronic
1166209015 19:41293672-41293694 CTATTGCAGGGGGCGGGGAATGG + Intronic
1166257184 19:41614969-41614991 AAAGGGAAGGGGAAGGGGAAGGG + Intronic
1166328990 19:42068124-42068146 CCATAGAAGAGGAAGGGGCAAGG + Intronic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166722035 19:45002156-45002178 CGAAAGAAGGGGAAGGGGCGGGG + Intronic
1166774230 19:45302763-45302785 CTACAGGAGGGGAAGGGGCCAGG + Exonic
1166892246 19:46000698-46000720 CTAGAGGAGGGGAAGGGGCCGGG + Intronic
1166954539 19:46454595-46454617 GGAAAGAAGGGGAAGGGGAAGGG - Intergenic
1167067234 19:47195675-47195697 GAAGCGAAGGGGAAGGGGAAGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1168373526 19:55856388-55856410 CACTGGAAGGGGAAGGGGAGTGG - Intronic
1168417072 19:56175942-56175964 CAATAGAAGGGAGGGGGGAAAGG - Intergenic
925107259 2:1302357-1302379 CTATAAATGGGGGAGGGAAAAGG + Intronic
925392752 2:3508917-3508939 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
925548265 2:5041686-5041708 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
925548312 2:5041809-5041831 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
925548325 2:5041838-5041860 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
925573400 2:5334881-5334903 AAAGGGAAGGGGAAGGGGAAAGG + Intergenic
925573408 2:5334899-5334921 AAAGGGAAGGGGAAGGGGAAAGG + Intergenic
925683984 2:6453052-6453074 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
925684015 2:6453123-6453145 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
925684030 2:6453156-6453178 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
925684043 2:6453184-6453206 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
925684065 2:6453229-6453251 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
925686664 2:6480461-6480483 CTTGTGAAGGGGCAGGGGAAAGG + Intergenic
925991751 2:9260080-9260102 CTATGGAGGTGGGAGGGGAAAGG + Intronic
926128786 2:10287309-10287331 CTCTAGAAGGGGAAGAGGGCAGG + Intergenic
927000634 2:18791045-18791067 GGAGGGAAGGGGAAGGGGAAAGG - Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927376856 2:22427315-22427337 CAAGGGAAGGGGATGGGGAATGG - Intergenic
927652019 2:24919012-24919034 CTAGAGAAGTGGACTGGGAACGG + Exonic
927693053 2:25221927-25221949 CTAGAGAAGAGGAAAGGGAAAGG + Intergenic
927699644 2:25259717-25259739 CTGGAGAAGGGGTGGGGGAAGGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
928110207 2:28501600-28501622 GGATAGAAAGGGTAGGGGAAGGG - Intronic
928726488 2:34179771-34179793 ATGTTGAAGGGAAAGGGGAAAGG - Intergenic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
930140914 2:47950587-47950609 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
930302208 2:49630634-49630656 AGAGAGAAGGGGAAGGGGAAAGG + Intergenic
930404415 2:50937277-50937299 CAAAAGAAGGGGAATGGAAAAGG - Intronic
930412711 2:51047091-51047113 TTAAAGACTGGGAAGGGGAAGGG - Intergenic
930649340 2:53948906-53948928 CTATAAAAGGGGAAGTTCAATGG + Intronic
931402615 2:61944851-61944873 GCAAAGATGGGGAAGGGGAAGGG + Intronic
931734182 2:65178989-65179011 CTTTAGAAGGCCAAGGGGAGAGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932040531 2:68294529-68294551 CTACAGAAGGGGAATGGCGAAGG + Intronic
932235038 2:70114178-70114200 CTACAGAAGGGCCAGGGGCATGG - Intergenic
933823792 2:86139833-86139855 TCATGGAATGGGAAGGGGAAGGG + Exonic
935082998 2:99817000-99817022 CTAGAGAAGGGGAAGAAGAATGG - Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935958704 2:108402846-108402868 CAATAGAAGGGGAAAAGAAAGGG - Intergenic
936354649 2:111739690-111739712 ACATAGGAAGGGAAGGGGAAGGG + Intergenic
936614507 2:114034559-114034581 AGAGAGAAAGGGAAGGGGAAGGG + Intergenic
936891953 2:117381328-117381350 CTATAGACTGGGAAGGGTAGGGG - Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937838099 2:126494279-126494301 GAAGAAAAGGGGAAGGGGAAGGG + Intergenic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938957675 2:136314504-136314526 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
939433822 2:142146868-142146890 TAATAGAAGTGGAAAGGGAAAGG + Intergenic
939509085 2:143084426-143084448 GTATAGAAGGGAGAGGGAAAAGG - Intergenic
939766126 2:146252154-146252176 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941038287 2:160590724-160590746 GGAAAGGAGGGGAAGGGGAAGGG - Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941288483 2:163644911-163644933 CTATGGCAGGGGAGGAGGAATGG + Intronic
941514454 2:166455550-166455572 GAAGAGAAGGGGAAGGGCAAGGG + Intronic
941640896 2:167987233-167987255 AGAGAAAAGGGGAAGGGGAAGGG - Intronic
941843874 2:170114432-170114454 CCACAGAAAGGAAAGGGGAAAGG + Intergenic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
942174889 2:173323799-173323821 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
942379759 2:175376642-175376664 GAAGAGAAGGGGAAGGGGAAGGG + Intergenic
943049632 2:182899458-182899480 CTAACGATGGGGAAGGGAAATGG - Intergenic
943070985 2:183140344-183140366 CCTTAAAAGGGGAAGAGGAAAGG - Intronic
943081694 2:183264771-183264793 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
943433666 2:187835361-187835383 CTGGAGAAGGGGAATGGGAGTGG - Intergenic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944036161 2:195296848-195296870 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
944070553 2:195663206-195663228 AGATAGGAGGGAAAGGGGAAGGG - Intronic
944096494 2:195974078-195974100 AGAAAGAAGGGGAAGGGGAAGGG + Intronic
946010496 2:216560149-216560171 AGAAGGAAGGGGAAGGGGAATGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946316577 2:218919387-218919409 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
947343619 2:229166961-229166983 GAAAGGAAGGGGAAGGGGAAGGG + Intronic
948344328 2:237282655-237282677 GGAGAGAAGGGGGAGGGGAAGGG + Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948665766 2:239533933-239533955 CTACAGACAGGGAAGGGGTAGGG - Intergenic
948948288 2:241232980-241233002 AGGAAGAAGGGGAAGGGGAAGGG + Intronic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169178653 20:3542629-3542651 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1169514995 20:6306742-6306764 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1169920570 20:10730836-10730858 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
1169920581 20:10730863-10730885 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
1170272253 20:14540412-14540434 AAATAGAAGGGGAAGGGCAGGGG - Intronic
1170532640 20:17309853-17309875 AAGAAGAAGGGGAAGGGGAAGGG + Intronic
1170532654 20:17309910-17309932 AAAGGGAAGGGGAAGGGGAAGGG + Intronic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170736471 20:19017594-19017616 CTCTAGGAGAGGAGGGGGAAGGG - Intergenic
1170940661 20:20845568-20845590 CTATGGAAGGGGAGGGGTAGGGG + Intergenic
1171558170 20:26096770-26096792 CCACAGAAGGGGAAGGGCTAGGG + Intergenic
1172224410 20:33295824-33295846 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1172373354 20:34414835-34414857 CTACAGAAGTAGAAGGGGAATGG - Intronic
1172410774 20:34721216-34721238 GTATAGAGGAAGAAGGGGAAGGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172612222 20:36260663-36260685 ATAGAGCAGGGTAAGGGGAACGG + Intronic
1173112253 20:40202979-40203001 ATGAAGGAGGGGAAGGGGAAGGG + Intergenic
1173689936 20:44952919-44952941 CTAAAAAAGGGGAAGGGCCAGGG - Intronic
1173890687 20:46507239-46507261 CAAGGGAAAGGGAAGGGGAAGGG + Intronic
1173890689 20:46507245-46507267 AAAGGGAAGGGGAAGGGGAAAGG + Intronic
1174446858 20:50596387-50596409 CAACTGAAGAGGAAGGGGAAAGG + Intronic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174839987 20:53892712-53892734 AAAGAGAAGGGGAAAGGGAAAGG - Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175565014 20:59967755-59967777 GGAGGGAAGGGGAAGGGGAAGGG - Intronic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1175661431 20:60816323-60816345 TAATAAAAGGAGAAGGGGAAGGG - Intergenic
1175866949 20:62183753-62183775 TTATAAAAGGGGGACGGGAAAGG + Intronic
1176720418 21:10388133-10388155 AGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1177006374 21:15677160-15677182 CTAATAAGGGGGAAGGGGAAAGG + Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177677182 21:24316063-24316085 CCATAGGAGAGGAGGGGGAAAGG - Intergenic
1180153115 21:45962548-45962570 GTATTGAAGGGTGAGGGGAATGG + Intergenic
1180709837 22:17832153-17832175 ACTGAGAAGGGGAAGGGGAAGGG + Intronic
1180880717 22:19201813-19201835 TTATTGAGGAGGAAGGGGAACGG - Intronic
1181080738 22:20413204-20413226 CAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1181491402 22:23262778-23262800 CGAAGGAAGGGGAAGAGGAAGGG + Intronic
1181755102 22:25018178-25018200 CTCTAGTAGGGGAGGAGGAAAGG - Intronic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182483194 22:30622945-30622967 CTACAGAAGGGAAAGGCAAATGG - Intronic
1182547768 22:31085607-31085629 CTACCGAGGGGGAAGGGGAAGGG - Intronic
1182561897 22:31166583-31166605 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182772418 22:32804893-32804915 CTCTAGAAGAGGAATGGGAGGGG + Intronic
1183256600 22:36766347-36766369 CGAGAGAAGATGAAGGGGAAAGG + Intronic
1183999750 22:41664543-41664565 TTAAAGAAGGGGAAGAGGACAGG + Intergenic
1184370811 22:44080937-44080959 CGAAAGGAGAGGAAGGGGAATGG + Intronic
1185334364 22:50265026-50265048 CTCTAGGAGGTGAAGGGAAAGGG + Exonic
1185422111 22:50740552-50740574 CTGTAGACTGGGAAGGGGACCGG + Intronic
949551572 3:5116238-5116260 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
949610580 3:5699348-5699370 CTAAACAAGGGGGAGGGGAAGGG + Intergenic
950168244 3:10817311-10817333 ATGTAGAAGGGGAGAGGGAAAGG + Intronic
950427672 3:12933169-12933191 CCAAAGAAAGGGAAGGGAAAGGG + Intronic
950435071 3:12974559-12974581 CTATTCAAGTGGAAGGGAAATGG + Intronic
950757257 3:15185539-15185561 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
951113624 3:18834424-18834446 CTTTAGAAAGAGAAGGGAAAGGG - Intergenic
951571923 3:24072965-24072987 TTAAAGCAGGGAAAGGGGAAGGG - Intergenic
951795915 3:26538204-26538226 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
951930116 3:27955879-27955901 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
951942707 3:28098055-28098077 CAAAAAAAGGGGAAAGGGAATGG - Intergenic
952285380 3:31963262-31963284 TTATATAAGGAGAAGGGGATGGG - Intronic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
952708256 3:36401882-36401904 CAAGAGAAAGGGAAGGGGAAAGG + Intronic
953691254 3:45121669-45121691 CTAGAGATGGGGAGAGGGAATGG + Intronic
954479057 3:50780830-50780852 ATACTGGAGGGGAAGGGGAAGGG - Intronic
955567089 3:60258941-60258963 TATGAGAAGGGGAAGGGGAAGGG + Intronic
957019429 3:75108410-75108432 AGAGAGAAGGGGAAGGGGAAGGG + Intergenic
957040171 3:75330243-75330265 TAATAAAAGGGGAAGGAGAAAGG + Intergenic
957156898 3:76555416-76555438 AGAAAGAAGGAGAAGGGGAAGGG + Intronic
957210315 3:77250408-77250430 ATATTAAAGGGGAAGGGAAAAGG - Intronic
957374638 3:79340155-79340177 TTATATAAGGTGATGGGGAAAGG - Intronic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
958195963 3:90243279-90243301 CTGTAGAAGGGTATGTGGAATGG + Intergenic
958419150 3:93911913-93911935 CTGTAGAAGGGTATGTGGAATGG + Intronic
958906573 3:99948519-99948541 CCTGAGAAGGGGGAGGGGAAGGG + Intronic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959541731 3:107547776-107547798 CAATAGAAGGGAAAGAAGAAGGG - Intronic
960007290 3:112793452-112793474 CTTTAGTAGGGGAAGGGGAGTGG - Intronic
961044967 3:123701824-123701846 CAATAAAAGGGGAAGGAGAAAGG + Intronic
961105202 3:124234940-124234962 CAAGGTAAGGGGAAGGGGAATGG + Exonic
962024730 3:131536008-131536030 ATAGAGAAGGGGTAGGGGAATGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963414304 3:144975129-144975151 GAAAAGAAGGGGAAGGAGAAGGG - Intergenic
964146502 3:153470420-153470442 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
964833304 3:160910184-160910206 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
964833337 3:160910263-160910285 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965014708 3:163141617-163141639 CTATACTTGGGGAAGGGAAAAGG + Intergenic
965622243 3:170653732-170653754 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
966057881 3:175718166-175718188 CGAATGGAGGGGAAGGGGAAGGG + Intronic
966127991 3:176602680-176602702 CTAGAGGCTGGGAAGGGGAAGGG + Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966836131 3:184050860-184050882 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
967234740 3:187373239-187373261 ATAGAGAAGGGCAAGGAGAATGG + Intergenic
967493148 3:190116231-190116253 ATGTAGAAGAGGAAGAGGAAAGG + Intronic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968630639 4:1649174-1649196 AAAGGGAAGGGGAAGGGGAAGGG + Intronic
968846093 4:3042260-3042282 TTGTACGAGGGGAAGGGGAAGGG + Intergenic
969289144 4:6227574-6227596 CTTTTGAAGGGGAGGGAGAAAGG - Intergenic
969397687 4:6933296-6933318 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969558030 4:7926721-7926743 AGAAAGAAGGGGAAGGGGAATGG - Intronic
970359244 4:15291786-15291808 CTTTAGAAGGGGAGGTGAAATGG - Intergenic
970645298 4:18113832-18113854 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
970865615 4:20755650-20755672 ATAAAGCAGGGGAAGGGGATGGG + Intronic
970875910 4:20869909-20869931 CAATAAAAGGGGAAGAGCAATGG + Intronic
970878991 4:20906030-20906052 GAAGAGAAGGGGAAGGGGAAGGG - Intronic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971305153 4:25473376-25473398 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
971395435 4:26222762-26222784 CTACAAAAGGGGCAGAGGAAAGG + Intronic
971551552 4:27964347-27964369 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
971591953 4:28479872-28479894 CAAAAGAGGGGGAAGGGGATGGG + Intergenic
972127565 4:35789058-35789080 CAAGAGGAGGGGAAGGGGAGGGG + Intergenic
972427675 4:38949685-38949707 CCAGAGAAGGGGAAGGGAGAAGG - Intergenic
973610504 4:52632015-52632037 CAAGGGAAGGGGAAGGGGAAGGG + Intronic
973611404 4:52638914-52638936 CTATAAAAGGGAAGGGAGAATGG - Intronic
973611511 4:52639946-52639968 CTTTAGGAGGTCAAGGGGAAAGG - Intronic
973655607 4:53044575-53044597 AAAGAGAAGGGGAATGGGAAGGG - Intronic
973847654 4:54929347-54929369 CATTAAAAGGGGATGGGGAAAGG + Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974483513 4:62476116-62476138 CTATAGCAGTGGGAGGGGGAAGG - Intergenic
974660481 4:64881800-64881822 TGATAGAAGGGTAAGGAGAAAGG - Intergenic
974906871 4:68068713-68068735 CTATGGAAGGGGAATGGCCATGG - Exonic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975695514 4:77008935-77008957 CTTTAGATGGAGAAGTGGAAAGG + Intronic
975902310 4:79167081-79167103 CCAAAGAAGGGGAAACGGAAGGG + Intergenic
976259044 4:83128458-83128480 GCAGGGAAGGGGAAGGGGAAGGG - Intronic
976967004 4:91055753-91055775 GTATAGAGGGAGAAGGGGAGAGG - Intronic
977146587 4:93448924-93448946 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
977597225 4:98896403-98896425 GAATGGAAGGGGAAGGGGAAAGG + Intronic
977845764 4:101764751-101764773 CTATAGAGGGAGAGAGGGAAGGG - Intronic
978268533 4:106858872-106858894 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
978353962 4:107850633-107850655 CTATAGGAAGGGAAAGTGAAAGG - Intronic
978441231 4:108736167-108736189 CTTTGGAAGGCGAAGGGGAGAGG - Intergenic
979084097 4:116383656-116383678 TTATAGAAAGGGAAAGAGAAGGG - Intergenic
979397965 4:120211648-120211670 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
979542233 4:121898146-121898168 CTAGAGACTGGGAAGGGTAAGGG + Intronic
980650914 4:135713786-135713808 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
980947869 4:139340784-139340806 AAAAAGAAGGGGAAGGGGAGGGG - Intronic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
981950710 4:150403561-150403583 AAAAAGAAGGGGAAGGAGAAGGG - Intronic
981996469 4:150980644-150980666 AAAAGGAAGGGGAAGGGGAAGGG + Intronic
982364366 4:154559179-154559201 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
982717567 4:158824925-158824947 AGATTGAAGGGGTAGGGGAAAGG - Intronic
982917620 4:161232513-161232535 CTAGAGTAGGGCTAGGGGAATGG - Intergenic
982981767 4:162146709-162146731 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
984070306 4:175103258-175103280 AGAAAGAAGGAGAAGGGGAAGGG + Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984676056 4:182548889-182548911 CCATGGTAGGGGATGGGGAAGGG - Intronic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984944076 4:184957607-184957629 CAATTGAGGGAGAAGGGGAAGGG + Intergenic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
986723461 5:10577116-10577138 AAAGAAAAGGGGAAGGGGAAGGG - Intronic
986946594 5:13029110-13029132 GGAGGGAAGGGGAAGGGGAAGGG + Intergenic
986946672 5:13029309-13029331 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946684 5:13029342-13029364 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946699 5:13029378-13029400 GGGAAGAAGGGGAAGGGGAAGGG + Intergenic
987820723 5:22962859-22962881 CTACAGAAAGGGAAGAGGACTGG + Intergenic
988369491 5:30347522-30347544 CTATACAAGAGGAAGAGCAAGGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988654948 5:33200499-33200521 ATATTGAAGGAGATGGGGAAAGG - Intergenic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
988888650 5:35589154-35589176 ATAGAGAAGAGGAAGAGGAAGGG - Intergenic
989028070 5:37089008-37089030 CTATGGAAAGGAAAGGGGGAAGG + Intergenic
989718954 5:44502277-44502299 CTGCAATAGGGGAAGGGGAAAGG - Intergenic
989741556 5:44779268-44779290 AAAGGGAAGGGGAAGGGGAAGGG + Intergenic
990390466 5:55314557-55314579 CTCTAGAAGTGGAAGTGGCAAGG + Intronic
990994808 5:61721300-61721322 GTATAGGAGGCAAAGGGGAAAGG + Intronic
991166477 5:63569360-63569382 CTAGAACAGGAGAAGGGGAAGGG - Intergenic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
992791602 5:80219147-80219169 CAAGATCAGGGGAAGGGGAAAGG + Intronic
992797297 5:80264608-80264630 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
992937807 5:81727968-81727990 CCATAGAAAGGGCTGGGGAAAGG + Intronic
993348544 5:86817762-86817784 CTATTGGAGGGAAAGGGGAGGGG - Intergenic
993554678 5:89321227-89321249 TGAGGGAAGGGGAAGGGGAAAGG + Intergenic
993875344 5:93300021-93300043 CCAAAGAAGAGGAGGGGGAACGG + Intergenic
993887596 5:93434454-93434476 GAAGAGAGGGGGAAGGGGAAGGG - Intergenic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
993926590 5:93873380-93873402 GAAAGGAAGGGGAAGGGGAAGGG + Intronic
994098876 5:95873105-95873127 GAAAGGAAGGGGAAGGGGAAAGG - Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994377836 5:99035169-99035191 CTATTGAAGGACAAGGGGATTGG - Intergenic
994638091 5:102367541-102367563 GGAGGGAAGGGGAAGGGGAAGGG + Intergenic
995178067 5:109201439-109201461 CTAGAGATGGGGAAGGGGTGAGG + Intergenic
995217746 5:109614587-109614609 CTAGAGAAGGAGAGGGGAAATGG + Intergenic
995882453 5:116858281-116858303 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
995921291 5:117317135-117317157 ATAAAGAAGGGAAAGGGAAAAGG - Intergenic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996758296 5:126959122-126959144 CTATAGTATGGAAAGGGGGAAGG + Intronic
996996690 5:129705229-129705251 CAATAAAAGGGGAAGGAGAGAGG - Intronic
997192067 5:131946425-131946447 GAGGAGAAGGGGAAGGGGAAGGG - Intronic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997465702 5:134086701-134086723 GAAAAGAAGGAGAAGGGGAAGGG - Intergenic
999635305 5:153615781-153615803 CTAGAGATGGGGATGAGGAAGGG - Intronic
1000178108 5:158778117-158778139 CCATAAAAGGGAAAGGGAAAGGG + Intronic
1000727012 5:164784373-164784395 CTAAAGAAGAGAAAGGGGGAAGG + Intergenic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1001228088 5:169962939-169962961 GTATAGGATGGGAAGTGGAAGGG + Intronic
1001290529 5:170455296-170455318 AAGAAGAAGGGGAAGGGGAAGGG - Intronic
1001321590 5:170686932-170686954 CTGGAGAGGGGGAAGAGGAAGGG - Intronic
1001887771 5:175310998-175311020 CTACACAAAGGGAAGGGGAAAGG + Intergenic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002302112 5:178263115-178263137 CTAGAGATGGGGATGGGGATGGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002809385 6:612358-612380 CTAAAGTAGGAGAAGAGGAAGGG + Intronic
1002840159 6:898543-898565 CCATTGAAGGGAAAGGGGAAAGG - Intergenic
1003119193 6:3306143-3306165 CAATAGAAGGGGGAGGTGACAGG + Intronic
1003332632 6:5142637-5142659 CAGTAGAAGGGGGTGGGGAATGG - Intronic
1003977368 6:11356738-11356760 CTATACCAGGGGGAGGGGAAAGG - Intronic
1004198747 6:13529022-13529044 CCATGGAAGGGGGAGAGGAAGGG + Intergenic
1004462712 6:15853422-15853444 AAGCAGAAGGGGAAGGGGAAAGG - Intergenic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005223883 6:23619881-23619903 GGAAAGAAGGGGAAGGAGAAGGG + Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005277732 6:24238098-24238120 GAAGGGAAGGGGAAGGGGAAAGG + Intronic
1005777624 6:29153400-29153422 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1005827408 6:29642404-29642426 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1006305472 6:33215770-33215792 CTATATTAGGGGGAGGAGAAGGG - Intergenic
1006315645 6:33289911-33289933 CTACAGAAGGGTAAGGGAACAGG + Exonic
1006567621 6:34973869-34973891 GAAGTGAAGGGGAAGGGGAAGGG - Intronic
1006567632 6:34973897-34973919 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567640 6:34973914-34973936 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567648 6:34973931-34973953 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567666 6:34973971-34973993 CAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567687 6:34974028-34974050 GAAGAGAAGGGGAAGGGGAAGGG - Intronic
1006567714 6:34974095-34974117 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567737 6:34974147-34974169 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567758 6:34974194-34974216 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006567780 6:34974247-34974269 GAAGCGAAGGGGAAGGGGAAGGG - Intronic
1006567791 6:34974275-34974297 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567825 6:34974360-34974382 AAATGGAAGGGGAAGGGAAATGG - Intronic
1006567832 6:34974383-34974405 GAATGGAAGGGGAAGGGGAAGGG - Intronic
1006567840 6:34974400-34974422 GAAGGGAAGGGGAAGGGGAATGG - Intronic
1006633181 6:35443692-35443714 ATCTTGAAGAGGAAGGGGAATGG - Intergenic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007067684 6:39008457-39008479 CTATAGCAGGGGAGAGTGAAAGG + Intronic
1007235825 6:40390933-40390955 CTATAGAACTGGAAAGGGACTGG + Intergenic
1007264986 6:40589083-40589105 GTAGGGAAGAGGAAGGGGAAGGG + Intergenic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1008071494 6:47103242-47103264 GAATAGATGGGGAAGGGGAATGG - Intergenic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008349328 6:50471370-50471392 CTAAAGAAAGGGAAGAGGAAAGG + Intergenic
1008424260 6:51338528-51338550 CTAAAGAAGAAGATGGGGAAGGG - Intergenic
1008935063 6:56982510-56982532 GTATAGGAGGGGAATGGGAGTGG - Intronic
1009777447 6:68222824-68222846 CAAAAGAAGGGGAAGAAGAAGGG + Intergenic
1010185163 6:73135518-73135540 CTAGAGTAGGGGCAGGGGAGAGG - Intronic
1010248828 6:73687441-73687463 GTAGGGAAGGGGAGGGGGAAAGG - Intergenic
1010420537 6:75669489-75669511 CTTTAGAAGGATAATGGGAATGG + Intronic
1010869689 6:81022021-81022043 CTCAAAAATGGGAAGGGGAAGGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1012588082 6:100947269-100947291 CCATGGAAGGGAATGGGGAAAGG + Intergenic
1013076026 6:106772563-106772585 CATTAGAAAGGGCAGGGGAAAGG - Intergenic
1013269635 6:108534005-108534027 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013269647 6:108534061-108534083 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013275501 6:108581054-108581076 CCACAGAAGGGGCAGGGGCAGGG - Intronic
1013711116 6:112900310-112900332 GAATAGAAAGGGAAGGGAAAGGG - Intergenic
1014276461 6:119395267-119395289 TTATAGAGGGAGAAAGGGAAGGG + Intergenic
1014751422 6:125261045-125261067 AAAGAAAAGGGGAAGGGGAAGGG + Intronic
1015441920 6:133258580-133258602 CTATAGAAGGGGAGGAGGGCAGG - Intronic
1015451907 6:133379851-133379873 CTATAGAAGGTAATGTGGAAGGG - Intronic
1015616955 6:135087509-135087531 GTTGGGAAGGGGAAGGGGAAGGG - Intronic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016024280 6:139270136-139270158 TAATAGAAAGGTAAGGGGAATGG + Intronic
1016798856 6:148147531-148147553 CAATACAAGGAGAAGGGGAAGGG + Intergenic
1016799420 6:148153610-148153632 CTAAAGAAGGAGGAGGGGAATGG + Intergenic
1017195003 6:151690603-151690625 CTATAGAATGGGCAGGAGAAAGG - Exonic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017398882 6:154036524-154036546 CTAGAAAAGGGCAATGGGAATGG + Intronic
1018001383 6:159581453-159581475 CTGTAGGAGGGGAACGGGAAAGG + Intergenic
1018275923 6:162131490-162131512 CTATAGATGTGGAAGGGGTTTGG + Intronic
1018438486 6:163785621-163785643 ATATAGAAGGGGAAAGGGCATGG + Intergenic
1021377412 7:19924919-19924941 TTATAGAAGTGGAAAGGAAAAGG + Intergenic
1021414990 7:20373717-20373739 CTTCAGCAGGGGAAGGAGAAGGG - Intronic
1021468749 7:20977332-20977354 CTGTAGAAGGGGGTGGGGACAGG + Intergenic
1022149488 7:27586611-27586633 GAAATGAAGGGGAAGGGGAAGGG + Intronic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023003773 7:35840239-35840261 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1023829125 7:44028977-44028999 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1023882869 7:44330309-44330331 ATAGAGAAAGGGAGGGGGAATGG + Intronic
1024135165 7:46399457-46399479 TAATAATAGGGGAAGGGGAAGGG + Intergenic
1024527498 7:50361172-50361194 CTTTAAAAGGAGAAGGGAAAGGG - Intronic
1024577086 7:50773393-50773415 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1024729395 7:52237238-52237260 CTACAGCAGGGGAATTGGAATGG + Intergenic
1024737668 7:52323314-52323336 GAAAAGAAAGGGAAGGGGAAAGG - Intergenic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1025257775 7:57397245-57397267 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1025279175 7:57614556-57614578 CCACAGAAGGGGAAGGGCTAGGG - Intergenic
1025305556 7:57850944-57850966 CCACAGAAGGGGAAGGGCTAGGG + Intergenic
1026040639 7:66865597-66865619 AAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1026181676 7:68046770-68046792 CTGGAGAAGGGGAGGAGGAAAGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026676832 7:72435270-72435292 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1027397008 7:77767042-77767064 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1027397021 7:77767071-77767093 AAAGGGAAGGGGAAGGGGAAGGG - Intronic
1028455068 7:91029632-91029654 AAACAGAAGGGGAAGGGGAGAGG - Intronic
1028577371 7:92366951-92366973 CTAGGGAAGGGGAAGAAGAATGG + Intronic
1028614357 7:92748823-92748845 CTATAGGTGTGGATGGGGAATGG - Intronic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1029238173 7:99141085-99141107 CTACTGAAAGGGAAAGGGAAAGG + Intronic
1029392119 7:100282466-100282488 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029739426 7:102483234-102483256 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029757427 7:102582413-102582435 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029775367 7:102681474-102681496 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1029779372 7:102715642-102715664 CTATTGAAGGCCAAGAGGAAAGG - Intergenic
1030014952 7:105209619-105209641 AAAGAAAAGGGGAAGGGGAAAGG + Intronic
1030161940 7:106518307-106518329 GGAGAGAAGGGGAAGGGGAGAGG - Intergenic
1031128484 7:117803384-117803406 CAAAAGAGGGGAAAGGGGAAAGG + Intronic
1031214795 7:118877087-118877109 GGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031866120 7:127039965-127039987 GTATGGAGGGGAAAGGGGAAGGG + Intronic
1031906917 7:127470557-127470579 CTAGAGACTGGGAAGGGCAAGGG + Intergenic
1031912485 7:127532730-127532752 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804351 7:144937500-144937522 AAAGGGAAGGGGAAGGGGAAAGG - Intergenic
1033804404 7:144937635-144937657 GGAAGGAAGGGGAAGGGGAAAGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035338386 7:158144625-158144647 CGAGAGAAGGGGAAGGGGAAGGG + Intronic
1035856944 8:2985936-2985958 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1036238399 8:7062257-7062279 CCAGAGAAGGACAAGGGGAAAGG - Intergenic
1036505035 8:9347450-9347472 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1036576584 8:10033034-10033056 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1037119859 8:15269939-15269961 CTACAGAAGGGGAAAGAGAGTGG - Intergenic
1037229354 8:16636625-16636647 CTAGAGGATGGGAAGGGGAGAGG - Intergenic
1037940109 8:22944838-22944860 ATGTAGACGAGGAAGGGGAAGGG + Intronic
1038042640 8:23737997-23738019 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1038642273 8:29338049-29338071 CCATGCAAGGGGAAGGGGACTGG + Intronic
1039331311 8:36540080-36540102 CTACAGAATGGGAAGGGGGTGGG + Intergenic
1039476214 8:37840711-37840733 CCAGAGATGGGGAAAGGGAAGGG - Intronic
1039567623 8:38562806-38562828 TAACAGAAAGGGAAGGGGAAAGG - Intergenic
1041586770 8:59529828-59529850 AAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1042797517 8:72680595-72680617 GTATTGAAGGGTAAGGAGAATGG + Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044335157 8:90974042-90974064 CTATAGAAGAGAATGGGCAAAGG + Intronic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1045247197 8:100453397-100453419 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045247236 8:100453594-100453616 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045423897 8:102043743-102043765 AAAGGGAAGGGGAAGGGGAAGGG + Intronic
1045824432 8:106380110-106380132 TGGGAGAAGGGGAAGGGGAATGG - Intronic
1046060145 8:109129071-109129093 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1046289306 8:112136133-112136155 GTCTAGAAGGAGAAGAGGAAAGG - Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1047250671 8:123179962-123179984 GAGTAGAAAGGGAAGGGGAATGG + Exonic
1047298232 8:123589756-123589778 CTAGAGGAGGGGAAGGGCAGTGG - Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047884688 8:129236257-129236279 CTATTAAAGAGGAAAGGGAAGGG + Intergenic
1047980826 8:130180058-130180080 GAGGAGAAGGGGAAGGGGAAGGG + Intronic
1048884207 8:138896339-138896361 TTTTAAAAGGGGAAGGGTAAAGG + Intronic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049136784 8:140909166-140909188 CTGTTGGAAGGGAAGGGGAAGGG + Intronic
1049136787 8:140909172-140909194 GAAGGGAAGGGGAAGGGGAAGGG + Intronic
1050098323 9:2091305-2091327 CTATAGACAGGGATGGAGAACGG - Intronic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1051487335 9:17623075-17623097 ATAGGAAAGGGGAAGGGGAAGGG - Intronic
1051575920 9:18615365-18615387 ATATAGCAAGTGAAGGGGAAGGG - Intronic
1051660935 9:19426420-19426442 AGACAGGAGGGGAAGGGGAAGGG - Intronic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1051887444 9:21908905-21908927 CTATAAATGGGGAAGGGGAAGGG - Intronic
1052280225 9:26724364-26724386 ATACAGAAGGTGAAGAGGAAAGG - Intergenic
1052489926 9:29152645-29152667 CTATAGGAGGAAATGGGGAAAGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053072459 9:35109326-35109348 AACAAGAAGGGGAAGGGGAAGGG + Exonic
1055563483 9:77545211-77545233 CTTTAGAAGTGGAGGAGGAAAGG - Intronic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1055928540 9:81535989-81536011 CAATAAAAGAGTAAGGGGAAAGG - Intergenic
1055998512 9:82189294-82189316 CTACAGAAGAGGAGGAGGAAAGG - Intergenic
1056073548 9:83014865-83014887 CTATAGTGGGTGGAGGGGAAGGG - Intronic
1056431781 9:86535191-86535213 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1057774467 9:97995364-97995386 CTATATAATGGGAAGGGTATGGG - Intronic
1059033779 9:110731348-110731370 ATAAACAAGGGTAAGGGGAATGG + Intronic
1059256309 9:112934477-112934499 ATATAGCAGGGGATGGGGAGTGG - Intergenic
1059314576 9:113413051-113413073 CTAACGAAGGGGAAAAGGAAAGG + Intronic
1059352948 9:113678506-113678528 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1059471959 9:114511856-114511878 CTATAGCAGAGGAAGAGGTAGGG + Intergenic
1060379497 9:123153622-123153644 CTATAGAAAGAGAAGAGCAAAGG + Intronic
1060394435 9:123305561-123305583 GAAGGGAAGGGGAAGGGGAAAGG - Intergenic
1060702518 9:125770023-125770045 GTATAGAAGAGGAAATGGAAGGG + Intronic
1061054355 9:128214549-128214571 CTAGAGTAGGGGTAGGGGTAGGG + Intronic
1061331885 9:129899794-129899816 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1061380020 9:130250107-130250129 AGAAAGAAGGGGAAGGGGAAGGG - Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061885670 9:133590071-133590093 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1061885678 9:133590088-133590110 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1061947437 9:133916570-133916592 ATATGGATGGAGAAGGGGAAAGG + Intronic
1062355816 9:136161745-136161767 CCAAAGAAAGGGAAGGGAAAGGG - Intergenic
1062738053 9:138149564-138149586 GAAAGGAAGGGGAAGGGGAAGGG - Intergenic
1185925516 X:4141675-4141697 GCTGAGAAGGGGAAGGGGAAGGG - Intergenic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1186915257 X:14212292-14212314 CTATAAAAGTGGGAGGGGATGGG - Intergenic
1187353111 X:18540675-18540697 GAAGGGAAGGGGAAGGGGAAGGG - Intronic
1187569084 X:20482844-20482866 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1187650429 X:21397569-21397591 CTAGAGGATGGGAAGGGGAGTGG + Intronic
1187877196 X:23814294-23814316 CTTGAGGAGGGGAAGGGGAGAGG - Intergenic
1187920917 X:24200448-24200470 CAAAAGAAGGGGTAGGGAAAGGG + Intronic
1187940063 X:24372663-24372685 AGTAAGAAGGGGAAGGGGAACGG + Intergenic
1188033340 X:25289163-25289185 GAAGGGAAGGGGAAGGGGAAGGG - Intergenic
1188213876 X:27454500-27454522 CTCTATAAGGTAAAGGGGAAAGG - Intergenic
1188513346 X:30959897-30959919 TGGTAGAAGGTGAAGGGGAAGGG + Intronic
1188563486 X:31497453-31497475 ATAAAGAAGGGTAGGGGGAAAGG - Intronic
1188603363 X:31996911-31996933 CTATGGGAAGGGAAGAGGAAAGG + Intronic
1188608611 X:32067503-32067525 TAATAGAAGGGGAAAGGAAAGGG - Intronic
1189131661 X:38504658-38504680 GTATAAAGGGGGTAGGGGAAAGG + Intronic
1189254780 X:39629474-39629496 CTATAAAATGGGAATGGGAATGG + Intergenic
1189379933 X:40495506-40495528 TTATTAAAGGGGAAGGGAAACGG - Intergenic
1189413309 X:40792547-40792569 CTATAGAGAGAGAAAGGGAAGGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189750166 X:44212544-44212566 CTAGAGTAGGGGGAGGGGAGGGG + Intronic
1190225102 X:48539424-48539446 CAAGAGAAGGGGGCGGGGAAAGG - Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1190795749 X:53739657-53739679 GGATAGTAGGGGATGGGGAAGGG - Intergenic
1192029638 X:67495485-67495507 TGGCAGAAGGGGAAGGGGAAGGG - Intergenic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192980818 X:76339028-76339050 CCAAACAAGGGGAAGGGGAGAGG + Intergenic
1193721232 X:84990065-84990087 GAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1193775453 X:85635631-85635653 CTGCAGAAGGGGAAAAGGAACGG + Intergenic
1194453893 X:94079076-94079098 CTAGAGGAGGGGAAGGGAATGGG + Intergenic
1194833645 X:98656495-98656517 CTGGAGAACGGGAATGGGAATGG + Intergenic
1195161835 X:102179212-102179234 CCATGGAAAGGAAAGGGGAAAGG - Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196023276 X:111012574-111012596 CAATAAAAGGGGAATTGGAAAGG + Intronic
1196041998 X:111214823-111214845 CTAGAGTAGAGAAAGGGGAAAGG + Intronic
1196421966 X:115531914-115531936 CTCTAAATGGGGGAGGGGAAAGG + Intergenic
1196477393 X:116104520-116104542 CTTAGGAAAGGGAAGGGGAAGGG + Intergenic
1196727057 X:118905257-118905279 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1196798761 X:119523613-119523635 CTATAGGAGGAGAGGGGGATAGG + Intergenic
1196890811 X:120288910-120288932 CTATACTAGGGAGAGGGGAAAGG + Intronic
1197497949 X:127208903-127208925 CTATATTAGGAGAATGGGAAGGG + Intergenic
1197781642 X:130165821-130165843 CTAGAGCCGGGGAAGGGGAACGG + Exonic
1198218004 X:134574409-134574431 CTAGAGAAGGAGTGGGGGAAGGG - Intronic
1199140013 X:144299594-144299616 CTACAGCAGAGGAAGGGAAATGG + Intergenic
1199547530 X:149021949-149021971 CTAAAGAATGGGAAGGGAAAAGG - Intergenic
1199881313 X:151975578-151975600 GCACAGAGGGGGAAGGGGAAGGG + Intergenic
1200145052 X:153922057-153922079 CGGTTGAGGGGGAAGGGGAAGGG + Intronic
1200169762 X:154064132-154064154 GTAAAGACGGGGAACGGGAACGG - Intronic
1201230140 Y:11856260-11856282 AGAGGGAAGGGGAAGGGGAAGGG + Intergenic