ID: 1096785586

View in Genome Browser
Species Human (GRCh38)
Location 12:54015499-54015521
Sequence CCACCCATAAATTTTATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096785586_1096785589 -3 Left 1096785586 12:54015499-54015521 CCTGTTATAAAATTTATGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1096785589 12:54015519-54015541 TGGGTTTGTGAAAAGAAACGAGG 0: 1
1: 0
2: 1
3: 10
4: 203
1096785586_1096785591 16 Left 1096785586 12:54015499-54015521 CCTGTTATAAAATTTATGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1096785591 12:54015538-54015560 GAGGTCCCTGCATCCGGCCTAGG 0: 1
1: 1
2: 0
3: 12
4: 141
1096785586_1096785590 10 Left 1096785586 12:54015499-54015521 CCTGTTATAAAATTTATGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1096785590 12:54015532-54015554 AGAAACGAGGTCCCTGCATCCGG 0: 1
1: 1
2: 0
3: 6
4: 92
1096785586_1096785592 17 Left 1096785586 12:54015499-54015521 CCTGTTATAAAATTTATGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1096785592 12:54015539-54015561 AGGTCCCTGCATCCGGCCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096785586 Original CRISPR CCACCCATAAATTTTATAAC AGG (reversed) Intronic
904215596 1:28916096-28916118 CAAACCAAAAATTTTACAACTGG - Intronic
905141315 1:35847061-35847083 CCTCCCATATGTTTTAAAACAGG + Intronic
909173500 1:72324097-72324119 CCAGCCAATAATTTTATATCTGG + Intergenic
909850341 1:80454381-80454403 CCACACAAAATATTTATAACTGG - Intergenic
910158126 1:84243673-84243695 ACATCCATACATTTTATAGCAGG + Intergenic
911575950 1:99578342-99578364 ACACCCATATATTTTCTACCTGG - Intergenic
912930704 1:113957640-113957662 CCACCCTTAAAGTTAATGACTGG - Intronic
913137534 1:115907112-115907134 TCACCCACAAATTTTATCACTGG - Intergenic
914395533 1:147263932-147263954 GCACCATTAAATTTTATAAAAGG + Intronic
916640492 1:166723671-166723693 CCATTCAAACATTTTATAACGGG + Intergenic
918899059 1:190389195-190389217 TGACTTATAAATTTTATAACTGG - Intronic
919015263 1:192025268-192025290 CCACCCAGAAATCTCATTACTGG - Intergenic
919211196 1:194489287-194489309 CCTTCCATAATTTTTGTAACTGG + Intergenic
921635587 1:217488294-217488316 CCACCCAGAAAATTTATAAATGG - Intronic
1063624062 10:7672801-7672823 CAACCCATAAGTTTATTAACAGG + Intergenic
1064178711 10:13097421-13097443 CCACCCAAAAATTTTAGATAAGG - Intronic
1064591461 10:16896427-16896449 TCAACCATACATTTTATATCTGG - Intronic
1066665165 10:37775898-37775920 ACACCCATCCATCTTATAACAGG - Intergenic
1067698363 10:48551543-48551565 CCTCCCTTAAACTTTATAAGTGG + Intronic
1068880640 10:62045204-62045226 ACACCCATAAATTTTAGGAGTGG + Intronic
1071094258 10:81955082-81955104 ACAAACATATATTTTATAACAGG - Intronic
1071530338 10:86386151-86386173 CCACCCCAAAATTTTGTGACCGG - Intergenic
1071882001 10:89909670-89909692 CCAACCAAGAATTTTATATCCGG - Intergenic
1074449971 10:113551439-113551461 ACAACCATAAATTTGTTAACTGG - Intronic
1077448525 11:2617935-2617957 CCAACCATATATCTTATAAGAGG - Intronic
1077762909 11:5122999-5123021 TGATCCATAAATTTTATAAGTGG + Intergenic
1079217607 11:18527532-18527554 CCACCCATAAATGATAATACAGG + Intergenic
1087700154 11:101428118-101428140 CCACCCATGAATACTATACCTGG - Intergenic
1089278202 11:117353948-117353970 ACACCCGGAAATTTTTTAACAGG - Intronic
1091609595 12:1994433-1994455 CCTCCCATCAATTTTAAAATTGG - Intronic
1092735967 12:11583278-11583300 CCACCCATAATTTCTAAACCAGG + Intergenic
1096785586 12:54015499-54015521 CCACCCATAAATTTTATAACAGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1102359816 12:112275474-112275496 CCACCCAAAAGTTTTAGAGCTGG - Intronic
1103179669 12:118899200-118899222 CCACCCAAAAAGCTCATAACGGG - Intergenic
1106166377 13:27250557-27250579 CCACCCATATATTTAACACCCGG + Intergenic
1109156519 13:58917376-58917398 CAACCCATATATGTTATAAGGGG + Intergenic
1111719769 13:91927811-91927833 CAAGCCATGAATTTTATCACTGG + Intronic
1112791222 13:103004272-103004294 CCACCTATAAATTCTATAGCAGG - Intergenic
1114748360 14:25174892-25174914 CCAGTCTAAAATTTTATAACCGG - Intergenic
1116885350 14:50215370-50215392 TCACCCATAAATGCTGTAACAGG + Intronic
1117561214 14:56941089-56941111 CCACCCAGCAATTCTATTACTGG - Intergenic
1119091027 14:71781496-71781518 CCAGCCATAAATTTTATTTTGGG - Intergenic
1121747129 14:96305778-96305800 TCAACCATGATTTTTATAACTGG + Exonic
1126306072 15:47259436-47259458 TCAACTATAAATTTTATATCTGG - Intronic
1127135510 15:55918401-55918423 CCTCACCTAAATTTTATAGCTGG + Intronic
1129758314 15:78111963-78111985 TCACCCATAAACTCTCTAACTGG + Intronic
1132189837 15:99843684-99843706 CAACCTATTAATCTTATAACTGG - Intergenic
1137452957 16:48594279-48594301 TAACCCACAAATTTTAAAACAGG - Intronic
1146037646 17:29421762-29421784 CCCCCCAAAAATTTTTTAACTGG - Intronic
1146527132 17:33576736-33576758 CTACCCATAAATGCTATACCTGG + Intronic
1146841502 17:36159220-36159242 CGACCCATATATTTGATAAGGGG - Intergenic
1146853754 17:36246860-36246882 CGACCCATATATTTGATAAGGGG - Intronic
1146869661 17:36370752-36370774 CGACCCATATATTTGATAAGGGG - Intronic
1147072538 17:37971376-37971398 CGACCCATATATTTGATAAGGGG - Intergenic
1147084061 17:38050913-38050935 CGACCCATATATTTGATAAGGGG - Intronic
1147100008 17:38174880-38174902 CGACCCATATATTTGATAAGGGG - Intergenic
1149407929 17:56373975-56373997 CCACCCATAAATTTTTTTCTCGG + Intronic
1150083013 17:62258171-62258193 CAACCCATATATTTGATAAGGGG - Intergenic
1203173495 17_GL000205v2_random:174128-174150 CCACCTATCCATTTTACAACAGG + Intergenic
1153410918 18:4791457-4791479 CCAACCACAAATTTTATATCTGG + Intergenic
1154257041 18:12791604-12791626 CCACCAAAAAATATTATTACTGG + Intronic
1159163906 18:64678517-64678539 CCACCTATAGATTTGATAAGAGG + Intergenic
1165054301 19:33164333-33164355 CCACCCAGGAATTTTATACTTGG - Intronic
926115090 2:10207935-10207957 CCACTCATAAATTCAACAACTGG - Intronic
926543988 2:14216055-14216077 CAACTCATATAGTTTATAACTGG - Intergenic
926854027 2:17232458-17232480 CCAGACATTATTTTTATAACAGG - Intergenic
926954199 2:18275944-18275966 CCAACTGTAAATTCTATAACTGG - Intronic
927305371 2:21565527-21565549 AGCCCCATAAATTTTATAAAAGG - Intergenic
928826524 2:35428257-35428279 CCATCAATAGATATTATAACTGG + Intergenic
931929543 2:67114954-67114976 CAACTCATATATTTTTTAACTGG - Intergenic
933091045 2:78116823-78116845 CCACTAATAAATTGAATAACTGG + Intergenic
933443027 2:82338446-82338468 CCATCCCTAAATTTTCCAACAGG - Intergenic
936834896 2:116697385-116697407 CCAGCCCTAAAATTTAGAACAGG - Intergenic
943193239 2:184707807-184707829 CCACCCAGCAATCTTATTACTGG - Intronic
1170054303 20:12182293-12182315 CCACAAATTAATTGTATAACAGG + Intergenic
1172175875 20:32971441-32971463 ACTCCCAAAAATTCTATAACGGG + Intergenic
1172382651 20:34509094-34509116 TCACCCCTAAAATTTTTAACAGG + Exonic
1174837840 20:53875016-53875038 GCACACATAATTTTTATAAAAGG + Intergenic
1175465170 20:59185800-59185822 CCACCCATGACCATTATAACCGG + Intergenic
1176329483 21:5535770-5535792 CCACCTATCCATTTTACAACAGG + Intergenic
1176398274 21:6285181-6285203 CCACCTATCCATTTTACAACAGG - Intergenic
1176438883 21:6703923-6703945 CCACCTATCCATTTTACAACAGG + Intergenic
1176463145 21:7030992-7031014 CCACCTATCCATTTTACAACAGG + Intergenic
1176486706 21:7412771-7412793 CCACCTATCCATTTTACAACAGG + Intergenic
1181160018 22:20954429-20954451 CCAGCCATAATTTTTAAAAATGG - Intergenic
1182371058 22:29811221-29811243 CCAGCCTTAAATTTTTTAAAAGG + Intronic
1184969191 22:48003087-48003109 GGACCCATAAATTTTATAGCTGG - Intergenic
949835270 3:8262131-8262153 TCAACCACAAATTTTATACCTGG - Intergenic
950975676 3:17240823-17240845 CAACATATAAATTTTACAACCGG - Intronic
951220379 3:20062927-20062949 CAAACCATATATTTGATAACAGG - Intronic
952694782 3:36251830-36251852 CCAACCCAAAATTTTATATCCGG + Intergenic
955104268 3:55881675-55881697 CCTGCCATAAATTAAATAACTGG + Intronic
955681688 3:61507934-61507956 TCAACCATAAATTCTATATCTGG - Intergenic
957846063 3:85737190-85737212 AAAACCATAAATTTTATTACTGG + Intronic
958116846 3:89231713-89231735 TCAGCCATAAACTTTATAATGGG - Intronic
958530098 3:95317473-95317495 CAAACCATACATTTTATAAGAGG + Intergenic
959010364 3:101068877-101068899 CCACCCAGAAATTTTACACTTGG - Intergenic
960515484 3:118597839-118597861 ACACCAATACATTTTATGACTGG + Intergenic
960699940 3:120429568-120429590 CCATCCATAAATTTTGGGACTGG + Intronic
962917579 3:139918533-139918555 GCACTCATAAATTTTTTAATTGG - Intergenic
965424145 3:168500030-168500052 CCACACATAAAAATTATATCAGG - Intergenic
967077721 3:186019531-186019553 CCACCCAGCAATTTCATTACTGG + Intergenic
970419921 4:15896511-15896533 CCAGCCTTAAATTTTTTAAAAGG - Intergenic
971674529 4:29608630-29608652 CCATCTAGAAATTCTATAACTGG + Intergenic
974663160 4:64921210-64921232 CCAACCCTGAATTTTATATCTGG + Intergenic
975442702 4:74431118-74431140 ACATTCATAAAATTTATAACTGG + Intergenic
976336159 4:83889928-83889950 CCAACCATAAAATCTATACCTGG - Intergenic
977429806 4:96917044-96917066 TCACCCAGAAGTTTTATAGCAGG - Intergenic
982996843 4:162359850-162359872 TCAACCATGAATTTTATACCTGG - Intergenic
984611585 4:181845629-181845651 GCAGGCAGAAATTTTATAACTGG - Intergenic
986474163 5:8108690-8108712 CCCCCCATAAAGTTTTTACCAGG + Intergenic
989499707 5:42151040-42151062 CCACCCAGCAATCTTATTACTGG - Intergenic
993135890 5:83963611-83963633 CCACCAATTAATTTTATATTAGG + Intronic
995052421 5:107721097-107721119 CCAGCCAAAAATTTCATATCTGG + Intergenic
995659728 5:114467669-114467691 CCACCAAGAAATTTCATAAGTGG + Intronic
996058224 5:119003614-119003636 TCACCAATCAGTTTTATAACAGG + Intergenic
996489668 5:124078634-124078656 ACACCCACAATTTTTACAACAGG - Intergenic
996651940 5:125888737-125888759 CCACCAAAAAAATTAATAACAGG + Intergenic
997384271 5:133460111-133460133 GCCCCCATAAATTCTGTAACGGG + Intronic
999834548 5:155354769-155354791 CCAACCAAGAATTTTATATCTGG + Intergenic
1001830584 5:174785174-174785196 TCAAACAAAAATTTTATAACTGG - Intergenic
1005363503 6:25054776-25054798 AAACACATATATTTTATAACTGG - Intergenic
1006086974 6:31602914-31602936 CAACCCAAAAATTTTCCAACAGG - Intergenic
1008826149 6:55696690-55696712 CCAACCATAGAATTTTTAACCGG + Intergenic
1009357308 6:62766660-62766682 CCACCCATTCATTTTGTAGCAGG - Intergenic
1012615742 6:101277646-101277668 CCACCCAACACTCTTATAACTGG - Intergenic
1013729588 6:113148696-113148718 CCACCCATGGCTTTTTTAACTGG - Intergenic
1013737345 6:113242965-113242987 CCACCATTAATTTTTATAATTGG - Intergenic
1014131899 6:117845026-117845048 CAAGCCATAAATTTGATAAGGGG + Intergenic
1014839013 6:126195108-126195130 TTACCAATAACTTTTATAACAGG - Intergenic
1017277946 6:152592146-152592168 CGACCCAGAAATCTTATTACTGG + Intronic
1017613383 6:156215032-156215054 CAAACCATAGATCTTATAACGGG + Intergenic
1018273025 6:162100982-162101004 CCAACCATACATTTGATAAGAGG - Intronic
1020520306 7:9177283-9177305 ACACACATATATTTAATAACAGG - Intergenic
1024818703 7:53301900-53301922 CCTCCCTTGAGTTTTATAACGGG + Intergenic
1029982512 7:104892329-104892351 ACACACATCATTTTTATAACTGG - Intronic
1031904971 7:127450806-127450828 CAACCCAGCAATTTTATTACTGG + Intergenic
1039620626 8:38994235-38994257 CCAGCCAAAAATTTCAGAACTGG + Intronic
1042340563 8:67674648-67674670 CGACCCAGAAATTTCATTACTGG + Intronic
1043822407 8:84883869-84883891 CCACACAAACATGTTATAACAGG - Intronic
1044943431 8:97367045-97367067 CCAACCAAAAATTCTATATCAGG + Intergenic
1047260396 8:123253605-123253627 TCACTCATAAAATTTAAAACTGG - Exonic
1047959156 8:129998312-129998334 ACCCCCATATATTTCATAACAGG - Intronic
1048120673 8:131577721-131577743 TCACCCATTATTTTGATAACAGG - Intergenic
1051341750 9:16118663-16118685 CCACCCATAAATTCAAAAAGGGG - Intergenic
1055743648 9:79417782-79417804 CCACTTTTAAGTTTTATAACAGG + Intergenic
1058847742 9:108978724-108978746 CCACCCACCAATTTTAGACCAGG + Intronic
1203432612 Un_GL000195v1:104556-104578 CCACCTATCCATTTTACAACAGG - Intergenic
1186357830 X:8805880-8805902 CCACGCAAAATATTTATAACTGG + Intergenic
1187379967 X:18792835-18792857 ACTCCCAGAAATTCTATAACAGG - Intronic
1188530763 X:31138382-31138404 CAAGCCATAAATATTATATCTGG - Intronic
1189362655 X:40364742-40364764 CAACCCAGAAATCTTATTACTGG - Intergenic
1191225826 X:58042075-58042097 CCAACCACGAATTTTATATCTGG + Intergenic
1193052193 X:77113235-77113257 CCAACCCAAAATTTTATATCTGG + Intergenic
1193456561 X:81738275-81738297 CAAGCCATATATTTAATAACAGG - Intergenic
1197778316 X:130135386-130135408 CCACGTATTACTTTTATAACAGG + Intronic
1198156297 X:133964113-133964135 ACAGCCATAAATGTTAGAACTGG + Intronic
1200819285 Y:7565705-7565727 CTACCCAGCAATTTTATTACTGG + Intergenic